Incidental Mutation 'R7593:Nr2e1'
ID 587554
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Name nuclear receptor subfamily 2, group E, member 1
Synonyms tailless, Mtll, Tlx, Nr2e1
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R7593 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 42437959-42459628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 42439475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 348 (P348L)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
AlphaFold Q64104
Predicted Effect probably damaging
Transcript: ENSMUST00000019938
AA Change: P348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: P348L

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105498
AA Change: P136L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803
AA Change: P136L

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C T 5: 64,055,774 (GRCm39) A170V probably damaging Het
Acp6 A T 3: 97,073,266 (GRCm39) E102D probably benign Het
Acss1 T A 2: 150,461,688 (GRCm39) R632* probably null Het
Adamtsl1 G T 4: 86,259,450 (GRCm39) C832F probably damaging Het
Adgrg6 T G 10: 14,344,573 (GRCm39) M127L probably damaging Het
Alkbh1 A T 12: 87,487,095 (GRCm39) Y91* probably null Het
Arhgap35 A T 7: 16,298,786 (GRCm39) I93N probably damaging Het
Asic2 A T 11: 81,858,657 (GRCm39) D118E probably benign Het
Asprv1 G T 6: 86,605,762 (GRCm39) V203L probably damaging Het
Atad2b G A 12: 5,081,726 (GRCm39) D1212N probably benign Het
Atp4a A G 7: 30,424,105 (GRCm39) I960V probably benign Het
Bin1 G T 18: 32,552,932 (GRCm39) E186* probably null Het
Bmp10 A G 6: 87,410,651 (GRCm39) Y148C probably damaging Het
Ccdc152 T A 15: 3,310,137 (GRCm39) D246V probably damaging Het
Cdc16 A G 8: 13,827,605 (GRCm39) T504A probably benign Het
Cdh9 A T 15: 16,823,261 (GRCm39) D81V probably damaging Het
Cep162 A T 9: 87,086,250 (GRCm39) S1025T probably benign Het
Cidea A G 18: 67,493,283 (GRCm39) I101V probably benign Het
Clock G A 5: 76,384,145 (GRCm39) S478L possibly damaging Het
Cp T A 3: 20,020,494 (GRCm39) N162K probably benign Het
Crb1 C T 1: 139,164,978 (GRCm39) E1110K probably damaging Het
Cyp2b13 A T 7: 25,780,416 (GRCm39) I146L possibly damaging Het
D630045J12Rik A G 6: 38,172,429 (GRCm39) S580P possibly damaging Het
Dars2 T C 1: 160,885,113 (GRCm39) E224G probably damaging Het
Dcbld2 A G 16: 58,244,941 (GRCm39) T72A possibly damaging Het
Ddx11 A T 17: 66,433,193 (GRCm39) I8F possibly damaging Het
Dennd2d T C 3: 106,407,244 (GRCm39) F432L probably damaging Het
Dnah10 T C 5: 124,823,608 (GRCm39) V543A probably benign Het
Eef2k G A 7: 120,488,491 (GRCm39) probably null Het
Elmo1 A G 13: 20,474,610 (GRCm39) M345V probably benign Het
Ephb4 A G 5: 137,359,560 (GRCm39) M377V probably benign Het
Erbb4 C A 1: 68,293,758 (GRCm39) R711L probably damaging Het
Fads1 A G 19: 10,162,361 (GRCm39) E95G probably damaging Het
Farsa G A 8: 85,594,278 (GRCm39) probably null Het
Galntl6 A G 8: 58,230,293 (GRCm39) S42P probably damaging Het
Gga2 G A 7: 121,589,672 (GRCm39) T559M probably benign Het
Glipr1l2 G A 10: 111,928,465 (GRCm39) G120D probably damaging Het
Gm14226 A T 2: 154,866,114 (GRCm39) I24L unknown Het
Gprc5b G T 7: 118,583,492 (GRCm39) R126S probably damaging Het
Gys1 A G 7: 45,092,360 (GRCm39) D321G probably damaging Het
Hdlbp C T 1: 93,358,005 (GRCm39) A299T probably benign Het
Hic2 A G 16: 17,076,979 (GRCm39) T603A probably damaging Het
Hoxa11 A T 6: 52,220,524 (GRCm39) I253N probably damaging Het
Iglon5 A T 7: 43,126,064 (GRCm39) D222E probably benign Het
Inpp5d T A 1: 87,645,500 (GRCm39) S1023T possibly damaging Het
Kif21a C T 15: 90,828,064 (GRCm39) A1233T probably benign Het
Kif9 A T 9: 110,350,421 (GRCm39) T771S possibly damaging Het
Klre1 T A 6: 129,560,150 (GRCm39) C141S probably damaging Het
Lats1 A G 10: 7,577,476 (GRCm39) Y200C probably damaging Het
Lgr4 T A 2: 109,829,801 (GRCm39) L247H probably damaging Het
Lrrc37a T C 11: 103,391,778 (GRCm39) K1216E probably benign Het
Lrrc41 G A 4: 115,950,141 (GRCm39) R518H possibly damaging Het
Lrrk1 A G 7: 65,958,439 (GRCm39) V320A probably benign Het
Mcm9 C T 10: 53,506,088 (GRCm39) R62H probably benign Het
Mmp10 T G 9: 7,503,154 (GRCm39) L38R probably damaging Het
Mroh8 A G 2: 157,071,867 (GRCm39) L546P probably damaging Het
Mtcl2 A T 2: 156,882,776 (GRCm39) D425E probably benign Het
Myt1 T A 2: 181,439,532 (GRCm39) D393E possibly damaging Het
Mzb1 A T 18: 35,780,901 (GRCm39) I129N probably damaging Het
Nek10 A G 14: 14,826,955 (GRCm38) D51G probably benign Het
Nme5 A G 18: 34,700,201 (GRCm39) I148T probably benign Het
Nrp2 A G 1: 62,758,203 (GRCm39) E63G probably damaging Het
Or2d2 A T 7: 106,727,782 (GRCm39) S273T probably damaging Het
Or51ab3 A T 7: 103,200,956 (GRCm39) probably benign Het
Or52e3 A G 7: 102,869,471 (GRCm39) E182G probably damaging Het
Or52e5 A G 7: 104,718,704 (GRCm39) H10R probably benign Het
Or56a3 A G 7: 104,735,372 (GRCm39) T150A probably benign Het
Pak5 A G 2: 135,942,884 (GRCm39) S419P probably benign Het
Pfas C A 11: 68,881,921 (GRCm39) M25I Het
Prdm9 A G 17: 15,764,867 (GRCm39) S638P possibly damaging Het
Psd G A 19: 46,301,352 (GRCm39) T954I possibly damaging Het
Psph T C 5: 129,864,337 (GRCm39) probably benign Het
Ptprf A G 4: 118,069,593 (GRCm39) I1517T probably benign Het
Rassf8 A G 6: 145,761,129 (GRCm39) R152G probably benign Het
Rfx3 G A 19: 27,827,139 (GRCm39) T149I probably benign Het
Rfx8 A T 1: 39,722,838 (GRCm39) F260I probably damaging Het
Rnft1 C T 11: 86,384,023 (GRCm39) Q308* probably null Het
Rock2 A G 12: 17,008,241 (GRCm39) N528S probably benign Het
Rpp25l T C 4: 41,712,305 (GRCm39) R157G unknown Het
Ryr1 A T 7: 28,735,528 (GRCm39) N4083K probably damaging Het
Scd1 G T 19: 44,388,739 (GRCm39) T237N probably benign Het
Sema3d T C 5: 12,558,112 (GRCm39) F215L probably benign Het
Sema7a C T 9: 57,867,858 (GRCm39) T478I probably benign Het
Sftpc T C 14: 70,759,623 (GRCm39) T99A possibly damaging Het
Slc25a4 G A 8: 46,662,241 (GRCm39) T139I probably damaging Het
Snx27 T C 3: 94,410,272 (GRCm39) E468G possibly damaging Het
Snx33 T C 9: 56,834,058 (GRCm39) K4E possibly damaging Het
Soat1 A T 1: 156,268,148 (GRCm39) L253* probably null Het
Sycp2l A T 13: 41,326,192 (GRCm39) N749I probably damaging Het
Synj2bp A T 12: 81,557,664 (GRCm39) I47N probably damaging Het
Tmem82 T A 4: 141,343,605 (GRCm39) I222F probably damaging Het
Ube2o A T 11: 116,471,905 (GRCm39) L112Q possibly damaging Het
Vmn1r204 G A 13: 22,740,754 (GRCm39) W128* probably null Het
Vmn2r114 A T 17: 23,510,817 (GRCm39) Y554* probably null Het
Vmn2r62 A T 7: 42,437,213 (GRCm39) Y424N possibly damaging Het
Vmn2r70 A T 7: 85,215,312 (GRCm39) L74* probably null Het
Vmp1 T A 11: 86,477,377 (GRCm39) Y341F probably benign Het
Vps13a A T 19: 16,703,027 (GRCm39) V642D probably damaging Het
Vps33a T C 5: 123,674,619 (GRCm39) M383V probably benign Het
Vwf G A 6: 125,624,731 (GRCm39) V1827I Het
Zc3hav1 A G 6: 38,306,121 (GRCm39) Y644H probably benign Het
Zfp429 A C 13: 67,538,410 (GRCm39) C345G probably damaging Het
Zfp595 T C 13: 67,464,823 (GRCm39) H483R probably benign Het
Zfp748 G T 13: 67,690,638 (GRCm39) H207Q probably benign Het
Zfp758 T C 17: 22,593,939 (GRCm39) S142P probably damaging Het
Znfx1 A C 2: 166,898,145 (GRCm39) S260A probably benign Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42,444,449 (GRCm39) missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42,443,969 (GRCm39) missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42,443,975 (GRCm39) missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42,447,478 (GRCm39) missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42,444,377 (GRCm39) missense probably damaging 1.00
Dubious UTSW 10 42,447,483 (GRCm39) nonsense probably null
BB010:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42,443,964 (GRCm39) missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42,458,905 (GRCm39) splice site probably null
R1879:Nr2e1 UTSW 10 42,444,367 (GRCm39) critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42,448,774 (GRCm39) missense probably benign
R2426:Nr2e1 UTSW 10 42,439,481 (GRCm39) missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42,444,441 (GRCm39) missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42,454,187 (GRCm39) missense probably benign
R5305:Nr2e1 UTSW 10 42,447,483 (GRCm39) nonsense probably null
R5316:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42,448,780 (GRCm39) missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42,448,765 (GRCm39) missense probably benign
R7040:Nr2e1 UTSW 10 42,444,374 (GRCm39) missense probably damaging 0.99
R7765:Nr2e1 UTSW 10 42,450,433 (GRCm39) missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42,458,881 (GRCm39) missense probably benign 0.00
R8342:Nr2e1 UTSW 10 42,444,425 (GRCm39) missense probably damaging 1.00
R8916:Nr2e1 UTSW 10 42,443,864 (GRCm39) missense possibly damaging 0.94
R9145:Nr2e1 UTSW 10 42,448,948 (GRCm39) missense probably benign 0.02
R9189:Nr2e1 UTSW 10 42,454,268 (GRCm39) missense probably damaging 0.99
R9381:Nr2e1 UTSW 10 42,439,468 (GRCm39) missense probably damaging 1.00
R9499:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R9552:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
Z1177:Nr2e1 UTSW 10 42,444,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGACCTGCATGTAGATGTC -3'
(R):5'- TCCAGTAGTCATCCTGTGAAACAG -3'

Sequencing Primer
(F):5'- AGATGTCCATCTAATACTGCCC -3'
(R):5'- TCTGCTGCGGGAACAATATG -3'
Posted On 2019-10-24