Incidental Mutation 'R7594:Olfr1253'
ID587601
Institutional Source Beutler Lab
Gene Symbol Olfr1253
Ensembl Gene ENSMUSG00000075075
Gene Nameolfactory receptor 1253
SynonymsMOR231-19P, MOR231-18, MOR231-19P, GA_x6K02T2Q125-51193814-51192857, Olfr1253-ps1, Olfr1559-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89749467-89757090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89752562 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 89 (T89S)
Ref Sequence ENSEMBL: ENSMUSP00000151024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099765] [ENSMUST00000213484] [ENSMUST00000215185] [ENSMUST00000215988]
Predicted Effect probably benign
Transcript: ENSMUST00000099765
AA Change: T89S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097353
Gene: ENSMUSG00000075075
AA Change: T89S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.2e-46 PFAM
Pfam:7tm_1 39 285 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213484
AA Change: T89S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215185
AA Change: T89S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215988
AA Change: T89S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Olfr1253
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Olfr1253 APN 2 89752348 missense probably benign 0.12
IGL02287:Olfr1253 APN 2 89752614 nonsense probably null
IGL03149:Olfr1253 APN 2 89752828 unclassified probably null
R0017:Olfr1253 UTSW 2 89752021 missense possibly damaging 0.67
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1584:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R2008:Olfr1253 UTSW 2 89752073 missense possibly damaging 0.57
R2484:Olfr1253 UTSW 2 89752234 missense probably benign 0.00
R5135:Olfr1253 UTSW 2 89751895 missense possibly damaging 0.67
R5648:Olfr1253 UTSW 2 89752073 missense probably damaging 0.99
R6021:Olfr1253 UTSW 2 89752121 missense probably benign 0.13
R6952:Olfr1253 UTSW 2 89752627 missense possibly damaging 0.64
R7039:Olfr1253 UTSW 2 89752751 missense probably benign 0.01
R7088:Olfr1253 UTSW 2 89752099 missense probably benign 0.01
R7443:Olfr1253 UTSW 2 89751941 missense probably benign 0.01
R7444:Olfr1253 UTSW 2 89752759 missense probably benign 0.01
R7538:Olfr1253 UTSW 2 89752321 missense probably damaging 1.00
R7818:Olfr1253 UTSW 2 89751944 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGTCAATGATATTGGGACCGC -3'
(R):5'- CATTGCAACAATGGTGGGC -3'

Sequencing Primer
(F):5'- TCAATGATATTGGGACCGCAGAAAG -3'
(R):5'- GGCAACCTGCTCATCGTAG -3'
Posted On2019-10-24