Incidental Mutation 'R7594:Dido1'
ID587605
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180675112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 634 (V634A)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037764] [ENSMUST00000087517] [ENSMUST00000103056] [ENSMUST00000103057]
Predicted Effect probably benign
Transcript: ENSMUST00000037764
AA Change: V94A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048315
Gene: ENSMUSG00000038914
AA Change: V94A

DomainStartEndE-ValueType
TFS2M 129 230 1.16e-45 SMART
low complexity region 397 422 N/A INTRINSIC
low complexity region 483 497 N/A INTRINSIC
Pfam:SPOC 512 618 4.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087517
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: V634A

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103056
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099345
Gene: ENSMUSG00000038914
AA Change: V634A

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103057
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914
AA Change: V634A

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7982:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTTGCCTAGTGGGAAAATTCC -3'
(R):5'- CCTTACTCTAATATGGCAGGAGC -3'

Sequencing Primer
(F):5'- GACCATCAATGCTACATCTGGGAG -3'
(R):5'- GGAGCCAAACCAGCCATTAAG -3'
Posted On2019-10-24