Incidental Mutation 'R7594:Atp8a1'
ID587615
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7594 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67651592 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 985 (Y985C)
Ref Sequence ENSEMBL: ENSMUSP00000042215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685
AA Change: Y985C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072971
AA Change: Y985C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: Y985C

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135930
AA Change: Y970C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: Y970C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGCTGAGAATCAAAGTAACAGAAATC -3'
(R):5'- CTTCATCTCTGGCCCCACAG -3'

Sequencing Primer
(F):5'- AGCTGCACACCTATATTGGG -3'
(R):5'- GGCTCTCCTTGTGTTCAAA -3'
Posted On2019-10-24