Incidental Mutation 'R7594:Mthfd2'
ID587620
Institutional Source Beutler Lab
Gene Symbol Mthfd2
Ensembl Gene ENSMUSG00000005667
Gene Namemethylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase
SynonymsNMDMC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83305691-83325908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83306683 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000005810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005810] [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900] [ENSMUST00000203847]
Predicted Effect probably benign
Transcript: ENSMUST00000005810
AA Change: V339A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005810
Gene: ENSMUSG00000005667
AA Change: V339A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 155 8.1e-45 PFAM
Pfam:THF_DHG_CYH_C 158 332 7.7e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039212
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113899
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113900
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203847
SMART Domains Protein: ENSMUSP00000145266
Gene: ENSMUSG00000005667

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:THF_DHG_CYH 39 108 2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Mthfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Mthfd2 APN 6 83310511 missense probably benign 0.12
IGL01844:Mthfd2 APN 6 83311810 critical splice donor site probably null
IGL02936:Mthfd2 APN 6 83311360 missense probably damaging 1.00
R0130:Mthfd2 UTSW 6 83309008 missense probably damaging 0.99
R0862:Mthfd2 UTSW 6 83313394 missense probably damaging 0.99
R1902:Mthfd2 UTSW 6 83306731 missense probably damaging 1.00
R3431:Mthfd2 UTSW 6 83311348 missense probably benign 0.30
R3732:Mthfd2 UTSW 6 83313475 missense probably damaging 1.00
R4473:Mthfd2 UTSW 6 83310535 unclassified probably benign
R5301:Mthfd2 UTSW 6 83310483 missense probably damaging 1.00
R5730:Mthfd2 UTSW 6 83317459 missense probably benign 0.35
R7126:Mthfd2 UTSW 6 83313490 missense probably benign 0.02
R7602:Mthfd2 UTSW 6 83311848 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCACCAGGTCAAAGGCAG -3'
(R):5'- ACCATGTGATCTTTGCCACG -3'

Sequencing Primer
(F):5'- ACAACTGATGGGCATCCTG -3'
(R):5'- GAGCATCTGTAACAGCTTGC -3'
Posted On2019-10-24