Incidental Mutation 'R7594:Vmn1r67'
ID587621
Institutional Source Beutler Lab
Gene Symbol Vmn1r67
Ensembl Gene ENSMUSG00000046716
Gene Namevomeronasal 1 receptor 67
SynonymsV1re10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10443331-10449202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10447415 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 202 (M202K)
Ref Sequence ENSEMBL: ENSMUSP00000060746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055964] [ENSMUST00000226237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055964
AA Change: M202K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060746
Gene: ENSMUSG00000046716
AA Change: M202K

DomainStartEndE-ValueType
Pfam:V1R 34 292 4.3e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226237
AA Change: M141K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Vmn1r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Vmn1r67 APN 7 10446840 missense possibly damaging 0.96
IGL02812:Vmn1r67 APN 7 10447018 missense probably benign 0.01
IGL03121:Vmn1r67 APN 7 10447467 missense probably benign 0.00
IGL03208:Vmn1r67 APN 7 10447098 missense possibly damaging 0.94
PIT4142001:Vmn1r67 UTSW 7 10446950 missense probably benign 0.13
R0048:Vmn1r67 UTSW 7 10446866 missense probably damaging 1.00
R0549:Vmn1r67 UTSW 7 10447714 missense probably damaging 1.00
R1595:Vmn1r67 UTSW 7 10447670 missense probably benign 0.18
R1608:Vmn1r67 UTSW 7 10446980 missense possibly damaging 0.82
R2284:Vmn1r67 UTSW 7 10447673 missense probably damaging 0.97
R3614:Vmn1r67 UTSW 7 10447429 missense probably damaging 0.98
R4399:Vmn1r67 UTSW 7 10447549 missense possibly damaging 0.89
R4542:Vmn1r67 UTSW 7 10447430 missense probably damaging 0.99
R5216:Vmn1r67 UTSW 7 10447163 missense probably benign 0.00
R5655:Vmn1r67 UTSW 7 10447388 missense probably benign 0.43
R5837:Vmn1r67 UTSW 7 10447022 missense probably benign 0.26
R6526:Vmn1r67 UTSW 7 10447671 missense probably benign 0.05
R6735:Vmn1r67 UTSW 7 10447211 missense probably damaging 1.00
R6846:Vmn1r67 UTSW 7 10446913 missense probably benign 0.04
R7086:Vmn1r67 UTSW 7 10447117 missense possibly damaging 0.93
R7227:Vmn1r67 UTSW 7 10447548 nonsense probably null
R7608:Vmn1r67 UTSW 7 10447363 missense possibly damaging 0.89
R7797:Vmn1r67 UTSW 7 10446976 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCAAAGTACATTGGGTGCTG -3'
(R):5'- CAAAAGAGCAATGCAGCCTTG -3'

Sequencing Primer
(F):5'- CAAAGTACATTGGGTGCTGCATTTTC -3'
(R):5'- GCAATGCAGCCTTGTAAAACAG -3'
Posted On2019-10-24