Incidental Mutation 'R7594:Zc3h12d'
ID587634
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7594 (G1)
Quality Score179.009
Status Not validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7862618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 229 (D229E)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably damaging
Transcript: ENSMUST00000039484
AA Change: D229E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: D229E

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAGGAGATGGGTCATTCCGC -3'
(R):5'- GACTCTGCACGATGACTGAC -3'

Sequencing Primer
(F):5'- AAGCTGTGTTGGTGTATACCCCATC -3'
(R):5'- CTCTGCACGATGACTGACTTAAGG -3'
Posted On2019-10-24