Incidental Mutation 'R7594:Ptcd2'
ID587642
Institutional Source Beutler Lab
Gene Symbol Ptcd2
Ensembl Gene ENSMUSG00000021650
Gene Namepentatricopeptide repeat domain 2
Synonyms1190005P08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location99319647-99344705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99320282 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 345 (A345S)
Ref Sequence ENSEMBL: ENSMUSP00000022153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022153
AA Change: A345S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022153
Gene: ENSMUSG00000021650
AA Change: A345S

DomainStartEndE-ValueType
Pfam:MRP-S27 20 228 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal mitochondrial morphology and physiology, especially in the heart, liver, skeletal muscle and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Ptcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ptcd2 APN 13 99330065 missense probably benign 0.11
IGL01537:Ptcd2 APN 13 99330013 missense possibly damaging 0.95
IGL01819:Ptcd2 APN 13 99326711 missense possibly damaging 0.78
IGL03368:Ptcd2 APN 13 99330069 splice site probably benign
PIT4431001:Ptcd2 UTSW 13 99340019 nonsense probably null
R0276:Ptcd2 UTSW 13 99321596 missense probably benign 0.16
R0411:Ptcd2 UTSW 13 99343391 missense probably damaging 1.00
R1381:Ptcd2 UTSW 13 99344597 missense probably benign 0.01
R2007:Ptcd2 UTSW 13 99320236 missense probably damaging 0.99
R4059:Ptcd2 UTSW 13 99344576 missense probably damaging 0.99
R4094:Ptcd2 UTSW 13 99332449 missense probably damaging 0.99
R7616:Ptcd2 UTSW 13 99344699 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACTGAAGTAAGTAAGATGCCCG -3'
(R):5'- ATGTGCCCTGGTGTTTATCC -3'

Sequencing Primer
(F):5'- TAAGTAAGATGCCCGGCCCG -3'
(R):5'- ATGCTGTACATTTCTACATGTCTG -3'
Posted On2019-10-24