Incidental Mutation 'R7594:Tnrc6b'
ID 587647
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R7594 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80880307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 670 (V670E)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: V670E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: V670E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Meta Mutation Damage Score 0.1710 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9029:Tnrc6b UTSW 15 80878978 missense possibly damaging 0.83
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTTGGAGGTCAAAGCACTGG -3'
(R):5'- TCCTCCCCAGTTAGAAGAGTTG -3'

Sequencing Primer
(F):5'- GGTCAAAGCACTGGAAGCAACC -3'
(R):5'- CTCCCCAGTTAGAAGAGTTGTTGTTC -3'
Posted On 2019-10-24