Incidental Mutation 'R7594:App'
ID587650
Institutional Source Beutler Lab
Gene Symbol App
Ensembl Gene ENSMUSG00000022892
Gene Nameamyloid beta (A4) precursor protein
SynonymsAdap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location84949685-85173766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85080002 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000005406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]
Predicted Effect unknown
Transcript: ENSMUST00000005406
AA Change: D167G
SMART Domains Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: D167G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
A4_EXTRA 24 188 5.33e-129 SMART
low complexity region 190 208 N/A INTRINSIC
Pfam:APP_E2 291 473 2.5e-77 PFAM
Pfam:Beta-APP 600 638 3.4e-28 PFAM
Pfam:APP_amyloid 641 691 8.6e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226232
AA Change: D167G
Predicted Effect unknown
Transcript: ENSMUST00000226801
AA Change: D167G
Predicted Effect possibly damaging
Transcript: ENSMUST00000227021
AA Change: D167G

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect unknown
Transcript: ENSMUST00000227723
AA Change: D167G
Predicted Effect unknown
Transcript: ENSMUST00000227737
AA Change: D167G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacad A G 11: 6,602,457 S245P probably damaging Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in App
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:App APN 16 84965711 missense probably damaging 0.99
IGL01457:App APN 16 85103239 missense probably damaging 1.00
IGL02016:App APN 16 85056521 missense unknown
IGL02135:App APN 16 85079838 critical splice donor site probably null
IGL02338:App APN 16 85173519 missense probably benign 0.01
IGL02377:App APN 16 85082831 missense probably benign 0.07
IGL02516:App APN 16 84955417 missense probably damaging 1.00
IGL02565:App APN 16 85025420 splice site probably null
IGL03179:App APN 16 85082847 missense probably damaging 1.00
LCD18:App UTSW 16 85025412 splice site probably benign
R0349:App UTSW 16 85013680 missense probably damaging 1.00
R0440:App UTSW 16 85056414 nonsense probably null
R0515:App UTSW 16 85103344 splice site probably benign
R0730:App UTSW 16 85079952 missense probably damaging 0.98
R1609:App UTSW 16 85079949 missense probably damaging 0.97
R1703:App UTSW 16 84965768 missense probably damaging 1.00
R2516:App UTSW 16 84978229 missense probably damaging 0.97
R4366:App UTSW 16 85056433 missense unknown
R4735:App UTSW 16 85103314 missense probably damaging 0.99
R4849:App UTSW 16 85056434 missense unknown
R4851:App UTSW 16 85056434 missense unknown
R6254:App UTSW 16 84978177 missense probably damaging 1.00
R6489:App UTSW 16 85056520 missense unknown
R6796:App UTSW 16 85120567 missense probably damaging 0.98
R7132:App UTSW 16 85056482 missense unknown
R7194:App UTSW 16 85025431 missense probably benign 0.40
R7456:App UTSW 16 85173560
R7528:App UTSW 16 84978258 missense possibly damaging 0.89
R7699:App UTSW 16 85040309 critical splice acceptor site probably null
R7700:App UTSW 16 85040309 critical splice acceptor site probably null
Z1176:App UTSW 16 85024917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAAGAGACGAGATGGCTC -3'
(R):5'- TCCGACTCTTCTAGCTGTGG -3'

Sequencing Primer
(F):5'- TCAGCCAATCTGAGACCCATC -3'
(R):5'- CTAGCTGTGGTTCGATTGTCC -3'
Posted On2019-10-24