Mutagenetix > Incidental Mutations

Incidental Mutation 'R7594:Umodl1'

587652

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7594 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30954805 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 20 (S20G)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: S20G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981
AA Change: S20G

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: S20G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (62/63)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	T	C	7: 104,059,263	E113G	probably damaging	Het
9530053A07Rik	T	C	7: 28,131,460	C33R	probably damaging	Het
Acsm3	A	G	7: 119,784,990		probably null	Het
Acvr2a	T	A	2: 48,894,737	L345*	probably null	Het
App	T	C	16: 85,080,002	D167G	unknown	Het
Arhgef33	A	G	17: 80,370,305	D427G	probably damaging	Het
Arid2	T	C	15: 96,390,994	S1675P	probably damaging	Het
Atp8a1	T	C	5: 67,651,592	Y985C		Het
AW209491	A	G	13: 14,637,246	D228G	probably benign	Het
Casc3	G	A	11: 98,821,485	A117T	probably benign	Het
Cass4	C	T	2: 172,429,648	P645S	probably benign	Het
Ccar2	A	T	14: 70,141,794	Y553*	probably null	Het
Cox16	A	T	12: 81,474,578		probably null	Het
Cpeb3	A	T	19: 37,174,151	V275E	possibly damaging	Het
Dido1	A	G	2: 180,675,112	V634A	probably benign	Het
Dnajb1	G	A	8: 83,609,844	S81N	probably benign	Het
Dst	A	G	1: 34,213,013	K2262E	probably damaging	Het
Eya3	T	C	4: 132,694,825	V237A	probably benign	Het
Fbxo31	T	A	8: 121,552,368	D460V	probably damaging	Het
Gabrg3	A	T	7: 56,982,695	N168K	possibly damaging	Het
Ggh	C	G	4: 20,049,833	S88C	probably damaging	Het
Gm10134	T	C	2: 28,506,360	M89T	unknown	Het
Gm13084	A	T	4: 143,812,716	I69N	probably damaging	Het
Kif17	T	C	4: 138,277,925	L267P	probably damaging	Het
Ksr2	C	A	5: 117,555,066	T193N	possibly damaging	Het
Lmtk2	T	C	5: 144,173,746	L428P	probably damaging	Het
Mdn1	G	T	4: 32,696,359	L1247F	probably benign	Het
Med24	T	C	11: 98,715,097	Y323C	probably damaging	Het
Mthfd2	A	G	6: 83,306,683	V339A	probably benign	Het
Mtus2	G	T	5: 148,077,406	R336S	probably benign	Het
Muc16	T	C	9: 18,645,062	T3312A	unknown	Het
Nacad	A	G	11: 6,602,457	S245P	probably damaging	Het
Nacc1	T	C	8: 84,675,002	D394G	probably damaging	Het
Nfatc2	A	G	2: 168,523,348	V582A	probably damaging	Het
Nid2	T	A	14: 19,768,723	D428E	probably benign	Het
Olfr1122	A	G	2: 87,388,269	H188R	probably damaging	Het
Olfr1253	T	A	2: 89,752,562	T89S	probably benign	Het
Olfr684	A	G	7: 105,157,673	L3S	probably benign	Het
Osbpl5	A	T	7: 143,693,797	L768Q	probably benign	Het
Plch2	C	T	4: 155,007,027	V210I	probably damaging	Het
Plekhh1	C	T	12: 79,076,503	T1153I	possibly damaging	Het
Ppp1r14c	T	C	10: 3,366,670	S2P	possibly damaging	Het
Psmd5	G	T	2: 34,860,729	H239Q	probably benign	Het
Ptcd2	C	A	13: 99,320,282	A345S	possibly damaging	Het
Sap30l	G	A	11: 57,810,121		probably null	Het
Sec14l2	A	G	11: 4,111,213	Y83H	probably damaging	Het
Slc2a9	A	G	5: 38,351,291	I470T	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Syne1	A	G	10: 5,215,190		probably null	Het
Tg	T	A	15: 66,729,583	D1766E	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tlr6	T	C	5: 64,953,251	Y771C	probably damaging	Het
Tnrc6b	T	A	15: 80,880,307	V670E	possibly damaging	Het
Top2b	A	G	14: 16,428,587	T1522A	probably benign	Het
Tpcn1	A	G	5: 120,556,530	M158T	possibly damaging	Het
Ttn	G	A	2: 76,751,354	T23065I	probably damaging	Het
Ttn	T	C	2: 76,726,842	I29940V	probably benign	Het
Uts2r	G	T	11: 121,161,365	V352F	possibly damaging	Het
Vmn1r67	T	A	7: 10,447,415	M202K	possibly damaging	Het
Vmn2r107	T	C	17: 20,360,373	V524A	probably benign	Het
Zc3h12d	C	A	10: 7,862,618	D229E	probably damaging	Het
Zfp541	A	G	7: 16,076,386	D116G	probably damaging	Het
Zfp971	A	G	2: 178,034,000	E464G	possibly damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
floored	UTSW	17	30988057	nonsense	probably null
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7915:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTCCTCTGAAGTCACTGC -3'
(R):5'- CTGCGGACTGTTGCTAATGG -3'

Sequencing Primer
(F):5'- TCTGAAGTCACTGCCACTAGC -3'
(R):5'- AGAGAAGATGCTTGCTGG -3'

Posted On

2019-10-24