Mutagenetix > Incidental Mutation

Incidental Mutation 'R7594:Umodl1'

587652

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7594 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30954805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 20 (S20G)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: S20G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981
AA Change: S20G

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: S20G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: S20G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (62/63)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	T	C	7: 104,059,263	E113G	probably damaging	Het
9530053A07Rik	T	C	7: 28,131,460	C33R	probably damaging	Het
Acsm3	A	G	7: 119,784,990		probably null	Het
Acvr2a	T	A	2: 48,894,737	L345*	probably null	Het
App	T	C	16: 85,080,002	D167G	unknown	Het
Arhgef33	A	G	17: 80,370,305	D427G	probably damaging	Het
Arid2	T	C	15: 96,390,994	S1675P	probably damaging	Het
Atp8a1	T	C	5: 67,651,592	Y985C		Het
AW209491	A	G	13: 14,637,246	D228G	probably benign	Het
Casc3	G	A	11: 98,821,485	A117T	probably benign	Het
Cass4	C	T	2: 172,429,648	P645S	probably benign	Het
Ccar2	A	T	14: 70,141,794	Y553*	probably null	Het
Cox16	A	T	12: 81,474,578		probably null	Het
Cpeb3	A	T	19: 37,174,151	V275E	possibly damaging	Het
Dido1	A	G	2: 180,675,112	V634A	probably benign	Het
Dnajb1	G	A	8: 83,609,844	S81N	probably benign	Het
Dst	A	G	1: 34,213,013	K2262E	probably damaging	Het
Eya3	T	C	4: 132,694,825	V237A	probably benign	Het
Fbxo31	T	A	8: 121,552,368	D460V	probably damaging	Het
Gabrg3	A	T	7: 56,982,695	N168K	possibly damaging	Het
Ggh	C	G	4: 20,049,833	S88C	probably damaging	Het
Gm10134	T	C	2: 28,506,360	M89T	unknown	Het
Gm13084	A	T	4: 143,812,716	I69N	probably damaging	Het
Kif17	T	C	4: 138,277,925	L267P	probably damaging	Het
Ksr2	C	A	5: 117,555,066	T193N	possibly damaging	Het
Lmtk2	T	C	5: 144,173,746	L428P	probably damaging	Het
Mdn1	G	T	4: 32,696,359	L1247F	probably benign	Het
Med24	T	C	11: 98,715,097	Y323C	probably damaging	Het
Mthfd2	A	G	6: 83,306,683	V339A	probably benign	Het
Mtus2	G	T	5: 148,077,406	R336S	probably benign	Het
Muc16	T	C	9: 18,645,062	T3312A	unknown	Het
Nacad	A	G	11: 6,602,457	S245P	probably damaging	Het
Nacc1	T	C	8: 84,675,002	D394G	probably damaging	Het
Nfatc2	A	G	2: 168,523,348	V582A	probably damaging	Het
Nid2	T	A	14: 19,768,723	D428E	probably benign	Het
Olfr1122	A	G	2: 87,388,269	H188R	probably damaging	Het
Olfr1253	T	A	2: 89,752,562	T89S	probably benign	Het
Olfr684	A	G	7: 105,157,673	L3S	probably benign	Het
Osbpl5	A	T	7: 143,693,797	L768Q	probably benign	Het
Plch2	C	T	4: 155,007,027	V210I	probably damaging	Het
Plekhh1	C	T	12: 79,076,503	T1153I	possibly damaging	Het
Ppp1r14c	T	C	10: 3,366,670	S2P	possibly damaging	Het
Psmd5	G	T	2: 34,860,729	H239Q	probably benign	Het
Ptcd2	C	A	13: 99,320,282	A345S	possibly damaging	Het
Sap30l	G	A	11: 57,810,121		probably null	Het
Sec14l2	A	G	11: 4,111,213	Y83H	probably damaging	Het
Slc2a9	A	G	5: 38,351,291	I470T	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Syne1	A	G	10: 5,215,190		probably null	Het
Tg	T	A	15: 66,729,583	D1766E	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tlr6	T	C	5: 64,953,251	Y771C	probably damaging	Het
Tnrc6b	T	A	15: 80,880,307	V670E	possibly damaging	Het
Top2b	A	G	14: 16,428,587	T1522A	probably benign	Het
Tpcn1	A	G	5: 120,556,530	M158T	possibly damaging	Het
Ttn	T	C	2: 76,726,842	I29940V	probably benign	Het
Ttn	G	A	2: 76,751,354	T23065I	probably damaging	Het
Uts2r	G	T	11: 121,161,365	V352F	possibly damaging	Het
Vmn1r67	T	A	7: 10,447,415	M202K	possibly damaging	Het
Vmn2r107	T	C	17: 20,360,373	V524A	probably benign	Het
Zc3h12d	C	A	10: 7,862,618	D229E	probably damaging	Het
Zfp541	A	G	7: 16,076,386	D116G	probably damaging	Het
Zfp971	A	G	2: 178,034,000	E464G	possibly damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCCTCTGAAGTCACTGC -3'
(R):5'- CTGCGGACTGTTGCTAATGG -3'

Sequencing Primer
(F):5'- TCTGAAGTCACTGCCACTAGC -3'
(R):5'- AGAGAAGATGCTTGCTGG -3'

Posted On

2019-10-24