Incidental Mutation 'R7595:Dytn'
ID587655
Institutional Source Beutler Lab
Gene Symbol Dytn
Ensembl Gene ENSMUSG00000069085
Gene Namedystrotelin
SynonymsLOC241073
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7595 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63622851-63686927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63659002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 282 (E282G)
Ref Sequence ENSEMBL: ENSMUSP00000087787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090313]
Predicted Effect probably damaging
Transcript: ENSMUST00000090313
AA Change: E282G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087787
Gene: ENSMUSG00000069085
AA Change: E282G

DomainStartEndE-ValueType
Pfam:EF-hand_2 5 118 8.2e-14 PFAM
Pfam:EF-hand_3 123 217 7.2e-20 PFAM
ZnF_ZZ 222 267 7.34e-13 SMART
coiled coil region 382 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Other mutations in Dytn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dytn APN 1 63678840 missense probably benign 0.34
IGL00870:Dytn APN 1 63677113 splice site probably benign
IGL02110:Dytn APN 1 63647473 missense possibly damaging 0.86
IGL02124:Dytn APN 1 63641092 missense probably damaging 1.00
IGL02211:Dytn APN 1 63674930 missense possibly damaging 0.61
IGL02712:Dytn APN 1 63664422 missense probably benign 0.00
IGL02832:Dytn APN 1 63643373 missense probably benign 0.45
IGL03036:Dytn APN 1 63641122 missense probably damaging 0.97
H8562:Dytn UTSW 1 63674912 missense possibly damaging 0.88
R0306:Dytn UTSW 1 63685113 missense possibly damaging 0.89
R0441:Dytn UTSW 1 63678774 splice site probably benign
R1453:Dytn UTSW 1 63633873 missense probably damaging 0.99
R1655:Dytn UTSW 1 63661198 missense probably damaging 1.00
R1892:Dytn UTSW 1 63677261 missense probably benign 0.04
R3030:Dytn UTSW 1 63633519 missense probably benign 0.04
R4062:Dytn UTSW 1 63647447 missense probably benign 0.05
R4640:Dytn UTSW 1 63643348 missense possibly damaging 0.52
R4804:Dytn UTSW 1 63643366 missense probably benign 0.08
R4931:Dytn UTSW 1 63633678 missense probably benign 0.26
R5015:Dytn UTSW 1 63633695 missense probably benign 0.00
R5054:Dytn UTSW 1 63661159 missense possibly damaging 0.64
R5120:Dytn UTSW 1 63623043 missense probably benign
R5888:Dytn UTSW 1 63677237 missense possibly damaging 0.91
R6243:Dytn UTSW 1 63647521 missense possibly damaging 0.76
R6400:Dytn UTSW 1 63641176 nonsense probably null
R7705:Dytn UTSW 1 63678789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTATGCTGGCTGTGTCAG -3'
(R):5'- AGGCTTGAACTGATCTGATGC -3'

Sequencing Primer
(F):5'- TGTGTCAGCAGCACCCAC -3'
(R):5'- CTGGCCTGATTTTATGACTTTTATTC -3'
Posted On2019-10-24