Incidental Mutation 'R7595:Kdm5b'
ID587656
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R7595 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134608966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 641 (D641E)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
Predicted Effect probably benign
Transcript: ENSMUST00000047714
AA Change: D641E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: D641E

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
AA Change: D641E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: D641E

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCTGGGAATCTGAGTCTAATTTAG -3'
(R):5'- GCCATTAAATACAACGTGGAAAAGC -3'

Sequencing Primer
(F):5'- GGAATCTGAGTCTAATTTAGGGTTG -3'
(R):5'- CAACGTGGAAAAGCTTCTTAAAACAG -3'
Posted On2019-10-24