Incidental Mutation 'R7595:Cdh22'
ID587659
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7595 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165112463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 713 (S713P)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably benign
Transcript: ENSMUST00000065438
AA Change: S713P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: S713P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R5649:Cdh22 UTSW 2 165116280 missense probably damaging 1.00
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGGCGAAGTCCTGCTC -3'
(R):5'- TGCTGATCCTCACTCTCAGG -3'

Sequencing Primer
(F):5'- TGTGCAGCGAGCTGAGC -3'
(R):5'- CTGAGCTCAGACGTGGATG -3'
Posted On2019-10-24