Incidental Mutation 'R7595:Fa2h'
ID 587674
Institutional Source Beutler Lab
Gene Symbol Fa2h
Ensembl Gene ENSMUSG00000033579
Gene Name fatty acid 2-hydroxylase
Synonyms Faxdc1, G630055L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R7595 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111345135-111393824 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111355490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 175 (I175F)
Ref Sequence ENSEMBL: ENSMUSP00000043597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038475]
AlphaFold Q5MPP0
Predicted Effect probably benign
Transcript: ENSMUST00000038475
AA Change: I175F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000043597
Gene: ENSMUSG00000033579
AA Change: I175F

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Cyt-b5 11 86 2.85e-15 SMART
low complexity region 115 126 N/A INTRINSIC
transmembrane domain 169 191 N/A INTRINSIC
Pfam:FA_hydroxylase 219 361 4.4e-21 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele show demyelination, axonal loss, and cerebellar dysfunction. Homozygotes for a different null allele show late onset axon and myelin sheath degeneration, delayed fur emergence, altered sebum composition, sebocyte hyperproliferation, and cyclic alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Fa2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Fa2h APN 8 111349304 missense possibly damaging 0.55
IGL02983:Fa2h APN 8 111346522 critical splice acceptor site probably null
IGL03350:Fa2h APN 8 111349296 missense probably benign 0.05
sparse UTSW 8 111355398 critical splice donor site probably null
R0016:Fa2h UTSW 8 111393514 missense probably damaging 1.00
R0363:Fa2h UTSW 8 111349289 missense probably damaging 1.00
R0576:Fa2h UTSW 8 111356147 missense probably damaging 1.00
R2914:Fa2h UTSW 8 111393649 missense probably damaging 1.00
R3803:Fa2h UTSW 8 111355398 critical splice donor site probably null
R3924:Fa2h UTSW 8 111393515 missense probably damaging 1.00
R5203:Fa2h UTSW 8 111349364 missense probably benign 0.00
R5253:Fa2h UTSW 8 111349237 missense probably benign 0.00
R6547:Fa2h UTSW 8 111348020 missense probably damaging 1.00
R8050:Fa2h UTSW 8 111348185 critical splice acceptor site probably null
R8530:Fa2h UTSW 8 111356156 missense probably benign 0.12
R9329:Fa2h UTSW 8 111355483 missense possibly damaging 0.49
R9366:Fa2h UTSW 8 111349374 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGGCTGTACTTTGAAGCG -3'
(R):5'- AACGGACTCAGCTTTGCCTC -3'

Sequencing Primer
(F):5'- GATGTGGTTTTCTATGCCCATAG -3'
(R):5'- GGACTCAGCTTTGCCTCTTTTC -3'
Posted On 2019-10-24