Incidental Mutation 'R7595:Bcar1'
ID587675
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Namebreast cancer anti-estrogen resistance 1
Synonymsp130Cas, Cas, Crkas
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7595 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111710474-111743809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111720993 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 117 (N117K)
Ref Sequence ENSEMBL: ENSMUSP00000129584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
Predicted Effect probably benign
Transcript: ENSMUST00000166232
AA Change: N117K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: N117K

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212349
AA Change: N117K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4130:Bcar1 UTSW 8 111714165 missense possibly damaging 0.47
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R6443:Bcar1 UTSW 8 111715338 missense probably damaging 1.00
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
R8373:Bcar1 UTSW 8 111715738 nonsense probably null
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGATGTCATGCCCTATGCCAG -3'
(R):5'- CTCAAGATTCTGGTTGGCATGTATG -3'

Sequencing Primer
(F):5'- ACCTGATAAATGTCCTGGGC -3'
(R):5'- CTGGTTGGCATGTATGATAAGAAGCC -3'
Posted On2019-10-24