Incidental Mutation 'R7595:Pcsk4'
ID587683
Institutional Source Beutler Lab
Gene Symbol Pcsk4
Ensembl Gene ENSMUSG00000020131
Gene Nameproprotein convertase subtilisin/kexin type 4
SynonymsPC4, SPC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7595 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80321283-80329498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80322101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 601 (D601V)
Ref Sequence ENSEMBL: ENSMUSP00000020340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000020341] [ENSMUST00000020349] [ENSMUST00000105359] [ENSMUST00000128653] [ENSMUST00000135071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020340
AA Change: D601V

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131
AA Change: D601V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020349
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105359
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
PHENOTYPE: Inactivation of this locus results in significantly reduced male fertility, putatively due to impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Alox12 T A 11: 70,242,404 E658V probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Pcsk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pcsk4 APN 10 80322823 missense probably damaging 1.00
IGL02818:Pcsk4 APN 10 80322792 missense probably damaging 0.98
IGL03115:Pcsk4 APN 10 80329049 missense probably damaging 1.00
IGL03354:Pcsk4 APN 10 80326059 missense probably damaging 0.99
R0538:Pcsk4 UTSW 10 80325334 missense probably damaging 1.00
R0760:Pcsk4 UTSW 10 80325941 unclassified probably benign
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1554:Pcsk4 UTSW 10 80321951 missense probably benign 0.01
R1728:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1784:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1886:Pcsk4 UTSW 10 80328960 missense probably benign 0.32
R1981:Pcsk4 UTSW 10 80325779 missense probably damaging 1.00
R2090:Pcsk4 UTSW 10 80325821 missense probably benign 0.02
R2125:Pcsk4 UTSW 10 80323879 missense probably benign 0.32
R2283:Pcsk4 UTSW 10 80322750 missense probably damaging 1.00
R4183:Pcsk4 UTSW 10 80325011 missense probably benign 0.12
R4283:Pcsk4 UTSW 10 80329453 unclassified probably benign
R4798:Pcsk4 UTSW 10 80323104 missense probably damaging 1.00
R4857:Pcsk4 UTSW 10 80325039 missense probably damaging 1.00
R4990:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R4991:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R5020:Pcsk4 UTSW 10 80326035 missense probably benign 0.00
R5123:Pcsk4 UTSW 10 80322145 missense probably null 0.56
R5354:Pcsk4 UTSW 10 80323689 missense probably damaging 0.98
R6077:Pcsk4 UTSW 10 80326239 missense probably damaging 0.99
R6102:Pcsk4 UTSW 10 80325817 nonsense probably null
R6250:Pcsk4 UTSW 10 80325592 missense probably benign 0.04
R6378:Pcsk4 UTSW 10 80328975 missense probably benign 0.34
R6729:Pcsk4 UTSW 10 80325101 missense probably damaging 0.99
R7308:Pcsk4 UTSW 10 80323173 missense probably benign 0.41
R8004:Pcsk4 UTSW 10 80322840 missense probably damaging 1.00
Z1176:Pcsk4 UTSW 10 80322726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGAGGGGACTGTGACTTTC -3'
(R):5'- GGCCACTAGCACATAGTAGGTAC -3'

Sequencing Primer
(F):5'- CTGTGACTTTCTGCATAGGGACAAC -3'
(R):5'- CCACTAGCACATAGTAGGTACAGTTG -3'
Posted On2019-10-24