Incidental Mutation 'R7595:Alox12'
ID587686
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Namearachidonate 12-lipoxygenase
SynonymsP-12LO, 9930022G08Rik, Alox12p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7595 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70241457-70255353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70242404 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 658 (E658V)
Ref Sequence ENSEMBL: ENSMUSP00000000329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000021180] [ENSMUST00000021181] [ENSMUST00000040428] [ENSMUST00000100950] [ENSMUST00000102569] [ENSMUST00000108575] [ENSMUST00000108576] [ENSMUST00000108577] [ENSMUST00000108578] [ENSMUST00000108579] [ENSMUST00000125752] [ENSMUST00000141880] [ENSMUST00000176116] [ENSMUST00000176268]
Predicted Effect probably damaging
Transcript: ENSMUST00000000329
AA Change: E658V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: E658V

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021180
SMART Domains Protein: ENSMUSP00000021180
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
Blast:SANT 38 69 1e-16 BLAST
SCOP:d1ba5__ 41 59 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021181
SMART Domains Protein: ENSMUSP00000021181
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040428
SMART Domains Protein: ENSMUSP00000048271
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100950
SMART Domains Protein: ENSMUSP00000098510
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 37 82 7.29e-1 SMART
low complexity region 105 128 N/A INTRINSIC
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102569
SMART Domains Protein: ENSMUSP00000099629
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108575
SMART Domains Protein: ENSMUSP00000104215
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108576
SMART Domains Protein: ENSMUSP00000104216
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108577
SMART Domains Protein: ENSMUSP00000104218
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108578
SMART Domains Protein: ENSMUSP00000104219
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108579
SMART Domains Protein: ENSMUSP00000104220
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125752
Predicted Effect probably benign
Transcript: ENSMUST00000141880
SMART Domains Protein: ENSMUSP00000135383
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176116
SMART Domains Protein: ENSMUSP00000135134
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176268
SMART Domains Protein: ENSMUSP00000135088
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts16 A G 13: 70,730,115 F1177S probably damaging Het
Anxa6 C A 11: 54,985,085 V591L probably benign Het
Atp6ap1l A T 13: 90,891,016 S141T probably damaging Het
Bcar1 A C 8: 111,720,993 N117K probably benign Het
Cdh22 A G 2: 165,112,463 S713P probably benign Het
Cideb T C 14: 55,754,804 D144G probably damaging Het
Coch T A 12: 51,598,233 V190D probably damaging Het
Cyp4a12a C A 4: 115,331,892 L473M probably damaging Het
Dennd1c A C 17: 57,071,633 L331R probably damaging Het
Dthd1 A G 5: 62,818,715 D244G probably benign Het
Dytn T C 1: 63,659,002 E282G probably damaging Het
Eml4 A G 17: 83,456,084 Q576R probably benign Het
Fa2h T A 8: 111,355,490 I175F probably benign Het
Fv1 A G 4: 147,870,170 T398A possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm4778 A G 3: 94,266,678 E327G probably benign Het
Gm5286 A G 3: 94,198,417 D14G probably benign Het
Gm5592 A G 7: 41,286,443 D123G probably damaging Het
Golph3l A G 3: 95,609,783 T201A probably benign Het
Ikbip A G 10: 91,096,585 S364G probably benign Het
Kcnc3 G A 7: 44,591,469 R195H probably damaging Het
Kdm5b T A 1: 134,608,966 D641E probably benign Het
Kif26a C T 12: 112,179,325 P1757S probably benign Het
Klf14 T C 6: 30,958,540 K53R probably benign Het
Klk1b4 A G 7: 44,210,708 D82G probably benign Het
Ly75 A G 2: 60,293,827 F1702S probably benign Het
Mfsd4b1 A T 10: 40,003,225 Y225* probably null Het
Olfr44 A C 9: 39,484,315 F313V probably benign Het
Pcsk4 T A 10: 80,322,101 D601V possibly damaging Het
Pkhd1l1 T A 15: 44,495,521 D375E probably damaging Het
Primpol A G 8: 46,610,615 L2S probably benign Het
Ralgapb G A 2: 158,426,165 V63I possibly damaging Het
Rptor T A 11: 119,743,953 N198K possibly damaging Het
Samd5 T C 10: 9,628,994 N172S probably benign Het
Sorbs1 A T 19: 40,314,653 H542Q probably damaging Het
Srgn T A 10: 62,508,006 probably benign Het
Taar6 C T 10: 23,985,070 V193I probably benign Het
Tmem132a G A 19: 10,858,205 A987V probably damaging Het
Trank1 T C 9: 111,365,991 Y1028H probably damaging Het
Ttc21a T C 9: 119,958,069 L714P probably benign Het
Wdfy4 C T 14: 32,974,154 probably null Het
Zswim9 T C 7: 13,261,072 D386G probably benign Het
Zwilch A G 9: 64,149,264 probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70254549 missense probably benign 0.12
IGL01629:Alox12 APN 11 70242834 missense probably damaging 1.00
IGL02657:Alox12 APN 11 70247278 missense probably benign
IGL02966:Alox12 APN 11 70250085 missense probably damaging 1.00
R0243:Alox12 UTSW 11 70242716 missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70242536 missense probably damaging 1.00
R0394:Alox12 UTSW 11 70245935 missense probably damaging 1.00
R0422:Alox12 UTSW 11 70254558 missense probably damaging 1.00
R0564:Alox12 UTSW 11 70252836 missense probably damaging 0.99
R0751:Alox12 UTSW 11 70246950 missense probably benign 0.00
R1539:Alox12 UTSW 11 70253243 splice site probably null
R1562:Alox12 UTSW 11 70250165 missense probably damaging 0.97
R2165:Alox12 UTSW 11 70242572 splice site probably null
R2295:Alox12 UTSW 11 70242465 missense probably benign 0.45
R4073:Alox12 UTSW 11 70247310 missense probably damaging 1.00
R4558:Alox12 UTSW 11 70253063 missense probably benign 0.03
R5081:Alox12 UTSW 11 70255314 splice site probably null
R5198:Alox12 UTSW 11 70254417 missense probably damaging 1.00
R5507:Alox12 UTSW 11 70254412 missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70243053 missense probably benign 0.00
R5832:Alox12 UTSW 11 70253280 missense probably damaging 0.98
R5975:Alox12 UTSW 11 70242783 missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70247055 missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70251587 missense probably benign 0.05
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70253110 missense probably damaging 1.00
R6505:Alox12 UTSW 11 70250204 missense probably damaging 1.00
R7320:Alox12 UTSW 11 70254472 missense probably benign 0.02
R7972:Alox12 UTSW 11 70242687 missense probably benign 0.15
X0025:Alox12 UTSW 11 70255224 missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70251479 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCCCTCCAAAGACTAAATTGTTCC -3'
(R):5'- TGGAGCCTGAATGGTCCTTTC -3'

Sequencing Primer
(F):5'- TAACAGCAAGACATTTAGTGCCCTG -3'
(R):5'- GAGCCTGAATGGTCCTTTCTTTCTG -3'
Posted On2019-10-24