Mutagenetix > Incidental Mutation

Incidental Mutation 'R7595:Adamts16'

587690

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 16

Synonyms

MMRRC Submission

045640-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7595 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70875921-70989930 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70878234 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1177 (F1177S)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably damaging
Transcript: ENSMUST00000080145
AA Change: F1177S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: F1177S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	T	C	7: 103,708,470 (GRCm39)	E113G	probably damaging	Het
Alox12	T	A	11: 70,133,230 (GRCm39)	E658V	probably damaging	Het
Anxa6	C	A	11: 54,875,911 (GRCm39)	V591L	probably benign	Het
Atp6ap1l	A	T	13: 91,039,135 (GRCm39)	S141T	probably damaging	Het
Bcar1	A	C	8: 112,447,625 (GRCm39)	N117K	probably benign	Het
Cdh22	A	G	2: 164,954,383 (GRCm39)	S713P	probably benign	Het
Cideb	T	C	14: 55,992,261 (GRCm39)	D144G	probably damaging	Het
Coch	T	A	12: 51,645,016 (GRCm39)	V190D	probably damaging	Het
Cyp4a12a	C	A	4: 115,189,089 (GRCm39)	L473M	probably damaging	Het
Dennd1c	A	C	17: 57,378,633 (GRCm39)	L331R	probably damaging	Het
Dthd1	A	G	5: 62,976,058 (GRCm39)	D244G	probably benign	Het
Dytn	T	C	1: 63,698,161 (GRCm39)	E282G	probably damaging	Het
Eml4	A	G	17: 83,763,513 (GRCm39)	Q576R	probably benign	Het
Fa2h	T	A	8: 112,082,122 (GRCm39)	I175F	probably benign	Het
Fv1	A	G	4: 147,954,627 (GRCm39)	T398A	possibly damaging	Het
Ggh	C	G	4: 20,049,833 (GRCm39)	S88C	probably damaging	Het
Gm5592	A	G	7: 40,935,867 (GRCm39)	D123G	probably damaging	Het
Golph3l	A	G	3: 95,517,094 (GRCm39)	T201A	probably benign	Het
Ikbip	A	G	10: 90,932,447 (GRCm39)	S364G	probably benign	Het
Kcnc3	G	A	7: 44,240,893 (GRCm39)	R195H	probably damaging	Het
Kdm5b	T	A	1: 134,536,704 (GRCm39)	D641E	probably benign	Het
Kif26a	C	T	12: 112,145,759 (GRCm39)	P1757S	probably benign	Het
Klf14	T	C	6: 30,935,475 (GRCm39)	K53R	probably benign	Het
Klk1b4	A	G	7: 43,860,132 (GRCm39)	D82G	probably benign	Het
Ly75	A	G	2: 60,124,171 (GRCm39)	F1702S	probably benign	Het
Mfsd4b1	A	T	10: 39,879,221 (GRCm39)	Y225*	probably null	Het
Or8g20	A	C	9: 39,395,611 (GRCm39)	F313V	probably benign	Het
Pcsk4	T	A	10: 80,157,935 (GRCm39)	D601V	possibly damaging	Het
Pkhd1l1	T	A	15: 44,358,917 (GRCm39)	D375E	probably damaging	Het
Primpol	A	G	8: 47,063,650 (GRCm39)	L2S	probably benign	Het
Ralgapb	G	A	2: 158,268,085 (GRCm39)	V63I	possibly damaging	Het
Rptor	T	A	11: 119,634,779 (GRCm39)	N198K	possibly damaging	Het
Samd5	T	C	10: 9,504,738 (GRCm39)	N172S	probably benign	Het
Sorbs1	A	T	19: 40,303,097 (GRCm39)	H542Q	probably damaging	Het
Spopfm1	A	G	3: 94,173,985 (GRCm39)	E327G	probably benign	Het
Spopfm3	A	G	3: 94,105,724 (GRCm39)	D14G	probably benign	Het
Srgn	T	A	10: 62,343,785 (GRCm39)		probably benign	Het
Taar6	C	T	10: 23,860,968 (GRCm39)	V193I	probably benign	Het
Tmem132a	G	A	19: 10,835,569 (GRCm39)	A987V	probably damaging	Het
Trank1	T	C	9: 111,195,059 (GRCm39)	Y1028H	probably damaging	Het
Ttc21a	T	C	9: 119,787,135 (GRCm39)	L714P	probably benign	Het
Wdfy4	C	T	14: 32,696,111 (GRCm39)		probably null	Het
Zswim9	T	C	7: 12,994,998 (GRCm39)	D386G	probably benign	Het
Zwilch	A	G	9: 64,056,546 (GRCm39)		probably benign	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70,943,603 (GRCm39)	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70,984,234 (GRCm39)	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70,941,260 (GRCm39)	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70,949,080 (GRCm39)	nonsense	probably null
IGL01874:Adamts16	APN	13	70,916,823 (GRCm39)	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70,935,266 (GRCm39)	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70,921,048 (GRCm39)	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70,886,704 (GRCm39)	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70,935,289 (GRCm39)	splice site	probably benign
IGL02450:Adamts16	APN	13	70,984,419 (GRCm39)	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70,886,897 (GRCm39)	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70,901,410 (GRCm39)	missense	probably benign	0.00
swap	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
switcheroo	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70,911,579 (GRCm39)	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70,927,763 (GRCm39)	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70,927,730 (GRCm39)	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70,927,671 (GRCm39)	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70,887,074 (GRCm39)	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70,916,766 (GRCm39)	missense	probably benign
R0524:Adamts16	UTSW	13	70,949,013 (GRCm39)	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70,949,073 (GRCm39)	missense	probably benign
R0734:Adamts16	UTSW	13	70,886,600 (GRCm39)	splice site	probably benign
R0787:Adamts16	UTSW	13	70,886,948 (GRCm39)	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70,916,811 (GRCm39)	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70,911,680 (GRCm39)	splice site	probably benign
R1027:Adamts16	UTSW	13	70,915,921 (GRCm39)	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70,984,253 (GRCm39)	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70,939,913 (GRCm39)	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70,946,154 (GRCm39)	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70,927,717 (GRCm39)	splice site	probably null
R1869:Adamts16	UTSW	13	70,883,866 (GRCm39)	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70,940,005 (GRCm39)	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70,901,386 (GRCm39)	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70,949,126 (GRCm39)	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70,901,345 (GRCm39)	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70,887,010 (GRCm39)	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70,916,111 (GRCm39)	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70,927,743 (GRCm39)	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70,927,637 (GRCm39)	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70,901,315 (GRCm39)	nonsense	probably null
R5464:Adamts16	UTSW	13	70,909,868 (GRCm39)	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70,878,253 (GRCm39)	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70,984,494 (GRCm39)	nonsense	probably null
R5735:Adamts16	UTSW	13	70,984,337 (GRCm39)	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70,886,617 (GRCm39)	missense	probably damaging	1.00
R5907:Adamts16	UTSW	13	70,877,029 (GRCm39)	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70,918,393 (GRCm39)	nonsense	probably null
R6351:Adamts16	UTSW	13	70,984,322 (GRCm39)	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70,927,689 (GRCm39)	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70,877,017 (GRCm39)	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70,916,639 (GRCm39)	splice site	probably null
R6996:Adamts16	UTSW	13	70,946,157 (GRCm39)	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70,921,074 (GRCm39)	nonsense	probably null
R7356:Adamts16	UTSW	13	70,984,399 (GRCm39)	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70,935,283 (GRCm39)	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70,984,265 (GRCm39)	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70,886,701 (GRCm39)	missense	probably benign
R8231:Adamts16	UTSW	13	70,925,599 (GRCm39)	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70,941,217 (GRCm39)	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70,984,496 (GRCm39)	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70,886,794 (GRCm39)	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70,984,453 (GRCm39)	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70,941,307 (GRCm39)	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70,939,910 (GRCm39)	splice site	probably benign
R8973:Adamts16	UTSW	13	70,886,959 (GRCm39)	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70,883,948 (GRCm39)	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70,901,408 (GRCm39)	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70,949,045 (GRCm39)	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70,949,136 (GRCm39)	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70,909,892 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGACATCACAAAAGGTTCTGTCC -3'
(R):5'- TGAGCTGAGCTGATGTCCTG -3'

Sequencing Primer
(F):5'- CCTTTCTTGGGTAGGATGAGAG -3'
(R):5'- ATGTCCTGGCAGCTTGTGAC -3'

Posted On

2019-10-24