Incidental Mutation 'R7596:Lcn2'
ID587702
Institutional Source Beutler Lab
Gene Symbol Lcn2
Ensembl Gene ENSMUSG00000026822
Gene Namelipocalin 2
SynonymsNGAL, 24p3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32384633-32388252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32385709 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 160 (Y160H)
Ref Sequence ENSEMBL: ENSMUSP00000053962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048792] [ENSMUST00000050785] [ENSMUST00000146423] [ENSMUST00000192241]
PDB Structure
Crystal Structure of Murine Siderocalin (Lipocalin 2, 24p3) [X-RAY DIFFRACTION]
Crystal Structure of Murine Siderocalin in Complex with an Fab Fragment [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048792
SMART Domains Protein: ENSMUSP00000038970
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 83 5.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050785
AA Change: Y160H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053962
Gene: ENSMUSG00000026822
AA Change: Y160H

DomainStartEndE-ValueType
Pfam:Lipocalin 48 195 2.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146423
SMART Domains Protein: ENSMUSP00000142021
Gene: ENSMUSG00000039195

DomainStartEndE-ValueType
Pfam:UPF0184 1 43 1.4e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192241
AA Change: Y246H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141430
Gene: ENSMUSG00000026822
AA Change: Y246H

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Pfam:Lipocalin 134 271 5.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants are more susceptible to infection with bacteria that utilize enterochelin-type siderophores to acquire iron and impaired thermogenesis. Mice homozygous for another knock-out allele exhibit apoptotic defects in hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Lcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Lcn2 APN 2 32387578 critical splice donor site probably null
IGL01327:Lcn2 APN 2 32386018 missense possibly damaging 0.62
IGL01913:Lcn2 APN 2 32387145 missense possibly damaging 0.46
IGL02108:Lcn2 APN 2 32387605 missense probably damaging 0.99
IGL02215:Lcn2 APN 2 32384865 makesense probably null
IGL02577:Lcn2 APN 2 32387089 missense probably damaging 0.97
IGL03129:Lcn2 APN 2 32387704 missense possibly damaging 0.70
R0302:Lcn2 UTSW 2 32384889 unclassified probably benign
R1864:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R1865:Lcn2 UTSW 2 32385422 missense possibly damaging 0.77
R4093:Lcn2 UTSW 2 32387716 start codon destroyed probably null 1.00
R4621:Lcn2 UTSW 2 32384643 unclassified probably benign
R5236:Lcn2 UTSW 2 32385961 missense probably benign 0.06
R5716:Lcn2 UTSW 2 32385813 missense possibly damaging 0.88
R6785:Lcn2 UTSW 2 32387027 critical splice donor site probably null
R7059:Lcn2 UTSW 2 32387596 missense possibly damaging 0.85
R7514:Lcn2 UTSW 2 32387849 critical splice donor site probably null
R7694:Lcn2 UTSW 2 32388030 missense unknown
R7778:Lcn2 UTSW 2 32387915 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTTCCTTCAGTTCAGGGG -3'
(R):5'- GGGGAGAACTCTTAGTTTGGAC -3'

Sequencing Primer
(F):5'- TTCCTTCAGTTCAGGGGACAGC -3'
(R):5'- TCTTAGTTTGGACAGACAGAACCC -3'
Posted On2019-10-24