Incidental Mutation 'R7596:Tnks1bp1'
ID587706
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85062713 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 995 (T995A)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: T333A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: T333A

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: T995A

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: T995A

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.86
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
R8345:Tnks1bp1 UTSW 2 85062882 missense possibly damaging 0.86
R8413:Tnks1bp1 UTSW 2 85062278 missense probably damaging 1.00
Z1176:Tnks1bp1 UTSW 2 85063530 missense probably damaging 0.99
Z1177:Tnks1bp1 UTSW 2 85059003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTGGACATCCATGGCAG -3'
(R):5'- GTAGGGCTCTGACTTTCTGC -3'

Sequencing Primer
(F):5'- ACATCCATGGCAGCCGGG -3'
(R):5'- CCCTGCAGCCTTGTGATC -3'
Posted On2019-10-24