Incidental Mutation 'R7596:Vsig10'
ID587714
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene NameV-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001033311; MGI: 2448533

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117319083-117355005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117334783 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 147 (V147A)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086464
AA Change: V120A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: V120A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111967
AA Change: V147A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: V147A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117338414 missense probably benign 0.00
IGL00340:Vsig10 APN 5 117351587 missense probably benign 0.03
IGL01082:Vsig10 APN 5 117334905 missense probably benign 0.33
IGL01285:Vsig10 APN 5 117324889 missense probably benign 0.43
IGL01790:Vsig10 APN 5 117338314 missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117325075 missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117343819 missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117335069 critical splice donor site probably null
R0403:Vsig10 UTSW 5 117338461 missense probably benign 0.05
R0674:Vsig10 UTSW 5 117343846 missense probably damaging 1.00
R1437:Vsig10 UTSW 5 117351570 missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117352760 missense probably benign 0.00
R1710:Vsig10 UTSW 5 117351654 missense probably benign
R1765:Vsig10 UTSW 5 117318815 unclassified probably benign
R4422:Vsig10 UTSW 5 117324921 missense probably benign 0.00
R4541:Vsig10 UTSW 5 117352816 utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117338243 missense probably benign 0.31
R4999:Vsig10 UTSW 5 117343975 missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117338270 missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117352749 critical splice acceptor site probably null
R6214:Vsig10 UTSW 5 117343924 missense probably damaging 1.00
R6418:Vsig10 UTSW 5 117348296 missense probably benign 0.03
R6505:Vsig10 UTSW 5 117351759 missense possibly damaging 0.95
R6854:Vsig10 UTSW 5 117338407 missense probably benign 0.36
R7121:Vsig10 UTSW 5 117343902 missense probably damaging 1.00
R8066:Vsig10 UTSW 5 117351784 missense probably benign 0.00
R8335:Vsig10 UTSW 5 117348370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCAAGATCAAGTGAGCAG -3'
(R):5'- CACGTGTAGTTGCCTTGGAG -3'

Sequencing Primer
(F):5'- AGAGATCCTTGGAACCTTGC -3'
(R):5'- TTTGGGACATGAGCATCAGC -3'
Posted On2019-10-24