Incidental Mutation 'R7596:Adam26b'
ID587723
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43520200 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 588 (D588E)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: D588E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: D588E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5935:Adam26b UTSW 8 43521298 missense probably benign 0.00
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
R7545:Adam26b UTSW 8 43521713 missense probably damaging 0.98
R7634:Adam26b UTSW 8 43520997 missense probably benign
R7657:Adam26b UTSW 8 43521542 missense possibly damaging 0.95
R7692:Adam26b UTSW 8 43520795 missense probably benign 0.00
R7769:Adam26b UTSW 8 43521695 missense probably benign 0.00
R7912:Adam26b UTSW 8 43520208 missense probably benign 0.13
R7993:Adam26b UTSW 8 43520208 missense probably benign 0.13
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Z1177:Adam26b UTSW 8 43520698 missense probably benign 0.24
Z1177:Adam26b UTSW 8 43521422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCTAAACTACCTCCATGGCC -3'
(R):5'- CTTTGGGAACTGTGGCAATG -3'

Sequencing Primer
(F):5'- ATGGCCACGTAGTTGACAGTC -3'
(R):5'- ACTGTGGCAATGATAGCTCTAAG -3'
Posted On2019-10-24