Incidental Mutation 'R7596:Kcnk1'
ID587725
Institutional Source Beutler Lab
Gene Symbol Kcnk1
Ensembl Gene ENSMUSG00000033998
Gene Namepotassium channel, subfamily K, member 1
SynonymsTWIK-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125995170-126030685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125995611 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 51 (L51P)
Ref Sequence ENSEMBL: ENSMUSP00000046103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046765] [ENSMUST00000212831]
Predicted Effect probably damaging
Transcript: ENSMUST00000046765
AA Change: L51P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046103
Gene: ENSMUSG00000033998
AA Change: L51P

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 49 68 N/A INTRINSIC
Pfam:Ion_trans_2 82 158 6.6e-19 PFAM
Pfam:Ion_trans_2 190 271 1.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212831
AA Change: L51P

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation reduced urinary flow rates and on a low phosphate diet display an attenuated ability to increase renal phosphate reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Kcnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Kcnk1 APN 8 126025407 missense possibly damaging 0.94
IGL01936:Kcnk1 APN 8 126025087 missense probably damaging 1.00
IGL02447:Kcnk1 APN 8 126025080 missense probably damaging 1.00
IGL02674:Kcnk1 APN 8 126025014 missense probably damaging 1.00
PIT4515001:Kcnk1 UTSW 8 126025342 missense probably damaging 1.00
R0735:Kcnk1 UTSW 8 126025289 missense probably damaging 1.00
R1350:Kcnk1 UTSW 8 126025228 missense probably benign 0.08
R1581:Kcnk1 UTSW 8 125995539 missense possibly damaging 0.50
R1789:Kcnk1 UTSW 8 126025384 missense possibly damaging 0.83
R2035:Kcnk1 UTSW 8 126025369 missense possibly damaging 0.56
R2125:Kcnk1 UTSW 8 125995656 missense probably damaging 0.99
R2906:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R2907:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R4710:Kcnk1 UTSW 8 126029528 missense probably damaging 1.00
R5698:Kcnk1 UTSW 8 126025405 missense probably damaging 1.00
R6591:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6647:Kcnk1 UTSW 8 125995460 start codon destroyed probably null 0.98
R6691:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6934:Kcnk1 UTSW 8 126025390 missense probably damaging 1.00
R7059:Kcnk1 UTSW 8 126029727 nonsense probably null
R7082:Kcnk1 UTSW 8 125995548 missense probably damaging 1.00
R7441:Kcnk1 UTSW 8 125995568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTATTTGCACGAAACCAGG -3'
(R):5'- CAGTACCCATATCGTGCTCC -3'

Sequencing Primer
(F):5'- TGTATTTGCACGAAACCAGGAAAGG -3'
(R):5'- ATATCGTGCTCCGGGGTCAC -3'
Posted On2019-10-24