Incidental Mutation 'R7596:Zbtb16'
ID587726
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Namezinc finger and BTB domain containing 16
SynonymsGreen's luxoid, Zfp145, PLZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location48654297-48836222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48832404 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 203 (V203L)
Ref Sequence ENSEMBL: ENSMUSP00000091374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093852
AA Change: V203L

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: V203L

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000216150
AA Change: V203L

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48665275 missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R4595:Zbtb16 UTSW 9 48832080 missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7751:Zbtb16 UTSW 9 48743469 missense probably damaging 1.00
R7904:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCTAGACTCAGCTGCC -3'
(R):5'- TGATGACAATGACACAGAGGCC -3'

Sequencing Primer
(F):5'- TAGACTCAGCTGCCCCAGG -3'
(R):5'- TGACACAGAGGCCACCATGG -3'
Posted On2019-10-24