Incidental Mutation 'R7596:Dcn'
ID587732
Institutional Source Beutler Lab
Gene Symbol Dcn
Ensembl Gene ENSMUSG00000019929
Gene Namedecorin
SynonymsDC, SLRR1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location97479609-97518143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97510009 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 228 (I228F)
Ref Sequence ENSEMBL: ENSMUSP00000100924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105287] [ENSMUST00000163448]
Predicted Effect probably damaging
Transcript: ENSMUST00000105287
AA Change: I228F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100924
Gene: ENSMUSG00000019929
AA Change: I228F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163448
AA Change: I228F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131431
Gene: ENSMUSG00000019929
AA Change: I228F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
LRRNT 48 80 3.86e-11 SMART
LRR 79 98 2.54e1 SMART
LRR 99 122 1.14e0 SMART
LRR_TYP 123 146 2.91e-2 SMART
LRR 147 167 1.67e2 SMART
LRR 168 193 1.29e2 SMART
LRR 194 217 5.27e1 SMART
LRR 239 262 6.05e0 SMART
LRR 263 286 1.01e-1 SMART
Meta Mutation Damage Score 0.8280 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded preproprotein is proteolytically processed to generate a mature protein product, which is secreted into the extracellular space to regulate collagen fibril assembly. Homozygous knockout mice for this gene exhibit enhanced tumorigenesis in a liver cancer model, and defects in collagen fibrils, leading to weakened skin and tendons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant mice have fragile skin and exhibit abnormal collagen morphology in skin and tendons, supporting this gene's role in regulating collagen fiber formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Dcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Dcn APN 10 97483523 missense probably damaging 1.00
IGL01776:Dcn APN 10 97495076 missense possibly damaging 0.88
IGL02608:Dcn APN 10 97483457 missense probably damaging 0.99
IGL02990:Dcn APN 10 97509973 missense probably benign 0.00
IGL03181:Dcn APN 10 97483452 missense probably damaging 0.98
IGL03268:Dcn APN 10 97483378 missense probably benign
PIT4791001:Dcn UTSW 10 97507742 missense probably benign
R0091:Dcn UTSW 10 97506689 missense probably benign 0.00
R0267:Dcn UTSW 10 97506483 splice site probably benign
R1759:Dcn UTSW 10 97513655 missense probably benign 0.01
R1845:Dcn UTSW 10 97506674 missense probably benign 0.00
R5322:Dcn UTSW 10 97517602 missense probably benign 0.03
R6613:Dcn UTSW 10 97495040 missense probably benign 0.03
R6650:Dcn UTSW 10 97507743 missense probably benign 0.00
R7392:Dcn UTSW 10 97509998 missense probably damaging 0.98
R7626:Dcn UTSW 10 97483478 missense possibly damaging 0.75
R7874:Dcn UTSW 10 97510194 splice site probably null
R8017:Dcn UTSW 10 97483535 missense probably damaging 1.00
R8049:Dcn UTSW 10 97513617 missense probably damaging 1.00
R8316:Dcn UTSW 10 97495077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAGTTCTTAACCTTATCAATG -3'
(R):5'- CAAGAATTCATCTGATAAGCTGGAG -3'

Sequencing Primer
(F):5'- AGTGTCACATCACTTTAAAGTATGC -3'
(R):5'- GCTGGAGTTTTACTTAAAAGCAAC -3'
Posted On2019-10-24