Mutagenetix > Incidental Mutations

Incidental Mutation 'R7596:Vmn2r109'

587750

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7596 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20540680 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 805 (M805K)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

Predicted Effect

probably damaging
Transcript: ENSMUST00000167093
AA Change: M805K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M805K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (53/56)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	G	A	16: 88,759,336	S146N	probably damaging	Het
Adam26b	A	C	8: 43,520,200	D588E	probably benign	Het
Ankrd13b	C	A	11: 77,472,314	R547L	probably benign	Het
Bckdk	G	T	7: 127,906,400	E232*	probably null	Het
C8a	T	C	4: 104,853,867	K244E	possibly damaging	Het
Cad	A	G	5: 31,069,048	I1145V	probably benign	Het
Cd28	C	A	1: 60,763,328	H135Q	possibly damaging	Het
Ceacam19	A	G	7: 19,881,887	I209T	possibly damaging	Het
Cecr2	A	G	6: 120,762,206	N1298S	probably benign	Het
Cpne5	C	T	17: 29,226,217	D38N	possibly damaging	Het
Dcn	A	T	10: 97,510,009	I228F	probably damaging	Het
Gm10696	T	A	3: 94,176,430	T25S	probably benign	Het
Gm5591	T	G	7: 38,520,184	I422L	probably benign	Het
Gnptab	T	G	10: 88,443,370	F1201V	probably damaging	Het
Hc	A	G	2: 35,000,847	V1319A	probably damaging	Het
Htr3b	T	C	9: 48,936,061	N385D	probably benign	Het
Ikbip	A	T	10: 91,083,029		probably benign	Het
Kcnk1	T	C	8: 125,995,611	L51P	probably damaging	Het
Lcn2	A	G	2: 32,385,709	Y160H	probably damaging	Het
Lig1	T	C	7: 13,305,998	S712P	probably damaging	Het
Lrrc19	T	G	4: 94,643,355	M7L	probably benign	Het
Lrrc4b	C	T	7: 44,461,886	T394M	probably damaging	Het
Map7	A	G	10: 20,278,181	N681S	unknown	Het
Mdga2	A	T	12: 66,506,123	M912K	probably damaging	Het
Mlst8	C	T	17: 24,478,110		probably null	Het
Ms4a13	A	T	19: 11,169,965	V195D	unknown	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Nr4a2	G	C	2: 57,108,231	F574L	probably damaging	Het
Nup107	T	C	10: 117,777,160	N288D	probably damaging	Het
Olfr1469	C	T	19: 13,411,147	H193Y	probably benign	Het
Olfr211	T	A	6: 116,494,197	V196D	probably benign	Het
Olfr742	A	T	14: 50,515,545	T114S	probably benign	Het
Pcolce	A	G	5: 137,606,825		probably null	Het
Pik3cg	A	G	12: 32,204,741	F416L	probably damaging	Het
Podnl1	A	G	8: 84,126,395	I65V		Het
Prpf8	T	C	11: 75,491,504	F387S	probably benign	Het
Rev3l	A	G	10: 39,821,538	Y677C	probably damaging	Het
Rhpn1	A	G	15: 75,712,313	T430A	probably benign	Het
Rnf187	T	C	11: 58,938,415	R124G	possibly damaging	Het
Rpl9-ps6	C	T	19: 32,466,383	V57I	probably benign	Het
Samhd1	A	T	2: 157,101,834	F587I	probably damaging	Het
Slc30a6	A	G	17: 74,415,669	T244A	probably benign	Het
Slc35f4	T	A	14: 49,306,209	Y310F	probably damaging	Het
Smarcc2	A	G	10: 128,482,793	Y648C	probably damaging	Het
Smc5	A	C	19: 23,214,169	V889G	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Tango2	A	G	16: 18,302,710	V229A	probably damaging	Het
Tnks1bp1	A	G	2: 85,062,713	T995A	probably benign	Het
Trio	A	T	15: 27,749,826	I2263N	probably damaging	Het
Ttc28	T	C	5: 111,280,124	F1829L	probably damaging	Het
Ttn	A	G	2: 76,808,579	S13920P	probably damaging	Het
Ube2b	T	C	11: 51,986,743	N133S	probably damaging	Het
Ubn1	T	A	16: 5,081,558	H1055Q	probably benign	Het
Ubtf	G	A	11: 102,306,707	T705M	unknown	Het
Vsig10	T	C	5: 117,334,783	V147A	possibly damaging	Het
Zbtb16	C	A	9: 48,832,404	V203L	possibly damaging	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGGTTTGATGCCACCAATTC -3'
(R):5'- CTTCCACTGTGTTCTGGGATAC -3'

Sequencing Primer
(F):5'- GGTTTGATGCCACCAATTCATAGAC -3'
(R):5'- GGATACCTCTGCTCCTTGGC -3'

Posted On

2019-10-24