Incidental Mutation 'R7596:Vmn2r109'
ID 587750
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7596 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20540680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 805 (M805K)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: M805K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M805K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGTTTGATGCCACCAATTC -3'
(R):5'- CTTCCACTGTGTTCTGGGATAC -3'

Sequencing Primer
(F):5'- GGTTTGATGCCACCAATTCATAGAC -3'
(R):5'- GGATACCTCTGCTCCTTGGC -3'
Posted On 2019-10-24