Incidental Mutation 'R7596:Vmn2r109'
ID587750
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Namevomeronasal 2, receptor 109
SynonymsEG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20540517-20564756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20540680 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 805 (M805K)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: M805K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: M805K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGTTTGATGCCACCAATTC -3'
(R):5'- CTTCCACTGTGTTCTGGGATAC -3'

Sequencing Primer
(F):5'- GGTTTGATGCCACCAATTCATAGAC -3'
(R):5'- GGATACCTCTGCTCCTTGGC -3'
Posted On2019-10-24