Incidental Mutation 'R7596:Smc5'
ID587756
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23214169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 889 (V889G)
Ref Sequence ENSEMBL: ENSMUSP00000084837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000226111]
Predicted Effect probably damaging
Transcript: ENSMUST00000087556
AA Change: V889G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: V889G

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223934
AA Change: V875G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226111
AA Change: V799G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Samhd1 A T 2: 157,101,834 F587I probably damaging Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
R7990:Smc5 UTSW 19 23235882 missense probably benign 0.01
R8255:Smc5 UTSW 19 23208926 missense
R8359:Smc5 UTSW 19 23234079 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTTTAAGGGGTTCAGCCACC -3'
(R):5'- CTTGAAGTACAGCAGTGTGC -3'

Sequencing Primer
(F):5'- TCTTTCACCTACAAGTAAGAGGC -3'
(R):5'- CAGTGGCATTTTTAGCCAG -3'
Posted On2019-10-24