Incidental Mutation 'R7597:Lamc1'
ID 587760
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 153218922-153332786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 153240454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 994 (K994E)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027752
AA Change: K994E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: K994E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163011
SMART Domains Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

DomainStartEndE-ValueType
coiled coil region 1 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153240495 missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153251134 missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153221573 missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153247082 missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153240433 missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153247042 missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153249853 missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153250661 missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153247055 missense probably benign 0.00
IGL03069:Lamc1 APN 1 153239381 missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153332274 missense probably benign 0.00
IGL03166:Lamc1 APN 1 153332301 missense probably benign 0.01
IGL03285:Lamc1 APN 1 153227685 missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153262646 missense probably damaging 1.00
pride UTSW 1 153247284 missense probably benign 0.01
Stratum UTSW 1 153251124 nonsense probably null
tier UTSW 1 153250522 missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153243471 missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153262583 missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153241868 unclassified probably benign
R0078:Lamc1 UTSW 1 153229190 missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153262607 missense probably benign 0.00
R0282:Lamc1 UTSW 1 153255312 missense probably benign
R0374:Lamc1 UTSW 1 153251065 splice site probably benign
R0494:Lamc1 UTSW 1 153246936 critical splice donor site probably null
R0502:Lamc1 UTSW 1 153246932 splice site probably benign
R0755:Lamc1 UTSW 1 153247450 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0792:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0892:Lamc1 UTSW 1 153332254 missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153332274 missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153221646 frame shift probably null
R0961:Lamc1 UTSW 1 153221700 missense probably benign 0.03
R0963:Lamc1 UTSW 1 153243386 missense probably benign
R1127:Lamc1 UTSW 1 153250459 missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153247231 splice site probably benign
R1175:Lamc1 UTSW 1 153247231 splice site probably benign
R1449:Lamc1 UTSW 1 153250495 missense probably benign
R1481:Lamc1 UTSW 1 153221634 missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153242743 missense probably benign 0.34
R1583:Lamc1 UTSW 1 153243478 critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153258072 splice site probably benign
R1652:Lamc1 UTSW 1 153249646 missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153247249 missense probably benign 0.04
R1854:Lamc1 UTSW 1 153249872 missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153242632 missense probably benign 0.07
R2170:Lamc1 UTSW 1 153249142 missense probably benign 0.07
R2410:Lamc1 UTSW 1 153247395 missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153226415 missense probably benign 0.04
R3615:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153255205 missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153262708 splice site probably null
R4285:Lamc1 UTSW 1 153234552 missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153221528 missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153247269 missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153242696 missense probably benign 0.04
R4649:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153229100 missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153233564 missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153251970 missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153247284 missense probably benign 0.01
R6233:Lamc1 UTSW 1 153223666 missense probably benign
R6431:Lamc1 UTSW 1 153221671 missense probably benign 0.21
R6636:Lamc1 UTSW 1 153241975 missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153262492 missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153226454 missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153234650 missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153249076 missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153332265 missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153243275 missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153243232 missense possibly damaging 0.71
R7635:Lamc1 UTSW 1 153249060 missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153247268 missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153221612 missense probably benign 0.04
R8207:Lamc1 UTSW 1 153250522 missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153247327 missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153223754 missense probably benign 0.04
R8315:Lamc1 UTSW 1 153243421 missense probably benign 0.00
R8417:Lamc1 UTSW 1 153230769 missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153233542 missense probably benign 0.31
R8827:Lamc1 UTSW 1 153221678 missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153332247 missense probably benign 0.00
R9061:Lamc1 UTSW 1 153251124 nonsense probably null
R9141:Lamc1 UTSW 1 153247450 missense probably benign 0.01
R9187:Lamc1 UTSW 1 153221688 nonsense probably null
R9206:Lamc1 UTSW 1 153250451 missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153243341 missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153239263 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGGAGCTTAGAGTAGACTTGAG -3'
(R):5'- GCTGCCCATATTACTTCACAAC -3'

Sequencing Primer
(F):5'- CTACTTCATGTCTGCTGAAGGAATG -3'
(R):5'- CTGCTACATGGACTTAGC -3'
Posted On 2019-10-24