Incidental Mutation 'R7597:Lnpk'
ID587765
Institutional Source Beutler Lab
Gene Symbol Lnpk
Ensembl Gene ENSMUSG00000009207
Gene Namelunapark, ER junction formation factor
Synonyms2310011O18Rik, lunapark, 9530051D01Rik, 4921514L11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location74520291-74579435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74568972 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 76 (M76V)
Ref Sequence ENSEMBL: ENSMUSP00000066891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064503] [ENSMUST00000102676] [ENSMUST00000111993] [ENSMUST00000130232] [ENSMUST00000130586] [ENSMUST00000134168]
Predicted Effect probably benign
Transcript: ENSMUST00000064503
AA Change: M76V

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066891
Gene: ENSMUSG00000009207
AA Change: M76V

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:zinc_ribbon_10 250 300 7.4e-25 PFAM
low complexity region 383 401 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102676
AA Change: M76V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099737
Gene: ENSMUSG00000009207
AA Change: M76V

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:DUF2296 250 300 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111993
AA Change: M76V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107624
Gene: ENSMUSG00000009207
AA Change: M76V

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:DUF2296 250 300 2.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130232
AA Change: M76V

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120494
Gene: ENSMUSG00000009207
AA Change: M76V

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130586
AA Change: M76V

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122488
Gene: ENSMUSG00000009207
AA Change: M76V

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134168
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: A semidominant X-ray-induced mutation results in severe length reductions of forelimb and hindlimb zeugopods, near absence of ulna, abnormal articulations in the carpus and tarsus, and genetic background-sensitive postnatal survival; heterozygous males do not breed and show increased bleeding times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Lnpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Lnpk APN 2 74529717 missense probably damaging 1.00
IGL02653:Lnpk APN 2 74548048 missense probably damaging 1.00
R0173:Lnpk UTSW 2 74551065 missense probably damaging 1.00
R0242:Lnpk UTSW 2 74537289 splice site probably benign
R1579:Lnpk UTSW 2 74547996 missense probably damaging 1.00
R2192:Lnpk UTSW 2 74569029 missense probably benign 0.13
R2698:Lnpk UTSW 2 74537501 missense probably damaging 1.00
R3788:Lnpk UTSW 2 74522263 missense probably benign 0.00
R3789:Lnpk UTSW 2 74522263 missense probably benign 0.00
R3790:Lnpk UTSW 2 74522263 missense probably benign 0.00
R4198:Lnpk UTSW 2 74569109 missense probably damaging 0.99
R4547:Lnpk UTSW 2 74522286 missense probably benign 0.14
R5244:Lnpk UTSW 2 74531888 missense probably damaging 1.00
R5347:Lnpk UTSW 2 74573591 start gained probably benign
R5516:Lnpk UTSW 2 74547788 intron probably benign
R5610:Lnpk UTSW 2 74548025 missense probably benign 0.02
R5859:Lnpk UTSW 2 74569028 missense possibly damaging 0.93
R5984:Lnpk UTSW 2 74522199 missense probably benign 0.00
R6788:Lnpk UTSW 2 74529676 missense probably benign 0.02
R8062:Lnpk UTSW 2 74551063 missense possibly damaging 0.90
Z1177:Lnpk UTSW 2 74573562 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGATATCCTTTGGGCTATAAAG -3'
(R):5'- GTCTTTGGCAATAGACTGATAGAC -3'

Sequencing Primer
(F):5'- GGGCTATAAAGTAGAAATTATCCTA -3'
(R):5'- GTGACTCACAACCATCTGTAATGGG -3'
Posted On2019-10-24