Incidental Mutation 'R7597:Nbn'
ID 587770
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Name nibrin
Synonyms Nbs1
MMRRC Submission 045672-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 15957925-15992589 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15963911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 104 (S104N)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
AlphaFold Q9R207
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: S104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: S104N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149069
AA Change: S104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: S104N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,644,661 (GRCm39) L838P probably damaging Het
Adam34l T G 8: 44,078,281 (GRCm39) N648H probably damaging Het
Adgrl4 T A 3: 151,248,895 (GRCm39) F728I probably damaging Het
Asap1 A G 15: 64,184,304 (GRCm39) V7A probably benign Het
B230104I21Rik A G 4: 154,434,050 (GRCm39) probably benign Het
C4b A T 17: 34,958,649 (GRCm39) S562T probably benign Het
Carmil2 A G 8: 106,422,121 (GRCm39) Y1130C probably damaging Het
Cit A T 5: 116,024,740 (GRCm39) K328* probably null Het
Col18a1 T C 10: 76,949,137 (GRCm39) D125G unknown Het
Cxadr T C 16: 78,125,996 (GRCm39) V122A probably damaging Het
Cyp2d22 G A 15: 82,260,053 (GRCm39) P44S probably damaging Het
Elapor1 A G 3: 108,378,745 (GRCm39) V351A possibly damaging Het
Gabrr1 A G 4: 33,148,964 (GRCm39) T74A probably benign Het
Gfm2 C A 13: 97,309,086 (GRCm39) A597E probably benign Het
H2-T22 T C 17: 36,351,408 (GRCm39) Y274C probably damaging Het
Has2 C A 15: 56,531,817 (GRCm39) W299C probably damaging Het
Hsd17b6 A G 10: 127,827,227 (GRCm39) S282P probably benign Het
Itga1 T C 13: 115,110,676 (GRCm39) I972V probably benign Het
Itih5 T A 2: 10,254,187 (GRCm39) Y813N probably damaging Het
Kctd16 A G 18: 40,663,848 (GRCm39) T326A possibly damaging Het
Klhdc1 T C 12: 69,316,642 (GRCm39) S342P probably damaging Het
Kmt2a T C 9: 44,742,650 (GRCm39) I1682M unknown Het
Lamc1 T C 1: 153,116,200 (GRCm39) K994E possibly damaging Het
Lig1 T G 7: 13,030,270 (GRCm39) S416A probably benign Het
Lims1 A G 10: 58,248,263 (GRCm39) E240G probably damaging Het
Lnpk T C 2: 74,399,316 (GRCm39) M76V probably benign Het
Lrrtm4 T A 6: 79,999,428 (GRCm39) L280* probably null Het
Mfap3l A T 8: 61,124,315 (GRCm39) I186F possibly damaging Het
Mta3 T C 17: 84,083,011 (GRCm39) F234L probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mybpc2 C T 7: 44,159,223 (GRCm39) G609D probably damaging Het
Naga A T 15: 82,219,035 (GRCm39) D237E probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nipsnap2 T C 5: 129,816,637 (GRCm39) L60P probably damaging Het
Or4f47 T A 2: 111,972,925 (GRCm39) F212I probably benign Het
Or8b1b G A 9: 38,375,802 (GRCm39) G155D probably benign Het
Pclo C T 5: 14,727,601 (GRCm39) T2153I unknown Het
Pclo A C 5: 14,908,869 (GRCm39) K5059T unknown Het
Pdlim2 C A 14: 70,403,645 (GRCm39) A256S possibly damaging Het
Pira2 T C 7: 3,845,460 (GRCm39) D308G probably damaging Het
Proc G T 18: 32,256,689 (GRCm39) A326E probably damaging Het
Rab40b T C 11: 121,248,709 (GRCm39) D182G probably benign Het
Rai14 A G 15: 10,574,937 (GRCm39) S703P possibly damaging Het
Rdx C T 9: 51,972,196 (GRCm39) P2L possibly damaging Het
Recql5 T C 11: 115,819,207 (GRCm39) K120E probably benign Het
Rev3l C T 10: 39,698,880 (GRCm39) R1126C probably damaging Het
Slc2a6 G T 2: 26,917,195 (GRCm39) D70E possibly damaging Het
Slc6a17 A T 3: 107,378,668 (GRCm39) D671E possibly damaging Het
Slc7a8 G A 14: 55,018,857 (GRCm39) probably benign Het
Srpk2 A G 5: 23,753,517 (GRCm39) Y79H possibly damaging Het
Traf3ip1 T A 1: 91,439,167 (GRCm39) I361K probably damaging Het
Trpm8 A G 1: 88,255,918 (GRCm39) Y191C probably damaging Het
Ubr3 T C 2: 69,803,812 (GRCm39) V1135A possibly damaging Het
Usp12 C A 5: 146,691,179 (GRCm39) probably null Het
Vmn1r44 C A 6: 89,870,818 (GRCm39) P188Q probably benign Het
Xirp2 T A 2: 67,356,099 (GRCm39) V3620D possibly damaging Het
Zcchc14 A T 8: 122,335,239 (GRCm39) S294T unknown Het
Zfp800 T C 6: 28,260,764 (GRCm39) D5G probably damaging Het
Zfp87 C T 13: 67,665,412 (GRCm39) R350Q probably benign Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15,964,320 (GRCm39) missense probably benign 0.01
IGL00921:Nbn APN 4 15,963,833 (GRCm39) missense possibly damaging 0.85
IGL01621:Nbn APN 4 15,965,221 (GRCm39) missense probably benign 0.45
IGL02372:Nbn APN 4 15,986,613 (GRCm39) missense probably benign 0.00
IGL03392:Nbn APN 4 15,962,362 (GRCm39) missense probably damaging 1.00
nebish UTSW 4 15,965,132 (GRCm39) critical splice acceptor site probably null
zenobia UTSW 4 15,969,391 (GRCm39) missense probably damaging 1.00
R0238:Nbn UTSW 4 15,986,672 (GRCm39) splice site probably benign
R0244:Nbn UTSW 4 15,979,353 (GRCm39) missense probably benign 0.00
R0432:Nbn UTSW 4 15,983,951 (GRCm39) unclassified probably benign
R0946:Nbn UTSW 4 15,970,719 (GRCm39) critical splice acceptor site probably null
R1076:Nbn UTSW 4 15,970,719 (GRCm39) critical splice acceptor site probably null
R1563:Nbn UTSW 4 15,981,668 (GRCm39) missense possibly damaging 0.77
R1579:Nbn UTSW 4 15,964,289 (GRCm39) missense probably damaging 0.99
R1660:Nbn UTSW 4 15,971,771 (GRCm39) missense probably benign 0.06
R1663:Nbn UTSW 4 15,970,903 (GRCm39) missense probably benign 0.13
R2005:Nbn UTSW 4 15,979,351 (GRCm39) missense probably benign 0.01
R2010:Nbn UTSW 4 15,969,393 (GRCm39) missense probably damaging 1.00
R2077:Nbn UTSW 4 15,979,389 (GRCm39) missense probably damaging 1.00
R2228:Nbn UTSW 4 15,970,904 (GRCm39) missense probably benign 0.01
R2229:Nbn UTSW 4 15,970,904 (GRCm39) missense probably benign 0.01
R2356:Nbn UTSW 4 15,970,863 (GRCm39) missense probably damaging 0.96
R2869:Nbn UTSW 4 15,963,810 (GRCm39) missense probably damaging 1.00
R2869:Nbn UTSW 4 15,963,810 (GRCm39) missense probably damaging 1.00
R3508:Nbn UTSW 4 15,962,387 (GRCm39) missense probably damaging 1.00
R3745:Nbn UTSW 4 15,976,163 (GRCm39) missense possibly damaging 0.67
R3753:Nbn UTSW 4 15,964,269 (GRCm39) missense probably damaging 0.98
R4756:Nbn UTSW 4 15,981,470 (GRCm39) missense probably benign 0.00
R5042:Nbn UTSW 4 15,981,446 (GRCm39) missense probably benign 0.10
R5177:Nbn UTSW 4 15,965,132 (GRCm39) critical splice acceptor site probably null
R5229:Nbn UTSW 4 15,963,893 (GRCm39) missense probably damaging 0.98
R5368:Nbn UTSW 4 15,969,391 (GRCm39) missense probably damaging 1.00
R5431:Nbn UTSW 4 15,986,593 (GRCm39) missense probably benign
R6025:Nbn UTSW 4 15,981,347 (GRCm39) missense probably damaging 0.97
R6375:Nbn UTSW 4 15,979,327 (GRCm39) missense probably benign
R6543:Nbn UTSW 4 15,986,605 (GRCm39) missense probably benign 0.39
R6655:Nbn UTSW 4 15,981,696 (GRCm39) missense probably damaging 0.98
R6965:Nbn UTSW 4 15,970,863 (GRCm39) missense probably benign 0.25
R7090:Nbn UTSW 4 15,981,350 (GRCm39) missense probably benign 0.06
R7159:Nbn UTSW 4 15,983,677 (GRCm39) splice site probably null
R7241:Nbn UTSW 4 15,991,190 (GRCm39) missense probably benign 0.00
R7267:Nbn UTSW 4 15,979,320 (GRCm39) missense probably benign 0.00
R7937:Nbn UTSW 4 15,958,080 (GRCm39) missense probably damaging 0.99
R8110:Nbn UTSW 4 15,981,588 (GRCm39) missense probably benign 0.02
R8317:Nbn UTSW 4 15,970,893 (GRCm39) missense probably damaging 0.96
R8327:Nbn UTSW 4 15,981,470 (GRCm39) missense probably benign 0.00
R8725:Nbn UTSW 4 15,963,911 (GRCm39) missense probably damaging 1.00
R8727:Nbn UTSW 4 15,963,911 (GRCm39) missense probably damaging 1.00
R8747:Nbn UTSW 4 15,981,555 (GRCm39) missense probably damaging 0.96
R8909:Nbn UTSW 4 15,970,833 (GRCm39) missense probably damaging 1.00
R8973:Nbn UTSW 4 15,986,585 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCACTTCCCCAGAAAGTTAG -3'
(R):5'- GACAATGTAACCAATGAGGACC -3'

Sequencing Primer
(F):5'- AGTAACTTGTGAGATCTACCCTG -3'
(R):5'- CCAAACAAGCTGAGTTCCCTGTTAC -3'
Posted On 2019-10-24