Mutagenetix > Incidental Mutation

Incidental Mutation 'R7597:Cit'

587776

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7597 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 115886681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 328 (K328*)

Ref Sequence

ENSEMBL: ENSMUSP00000062049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000051704
AA Change: K328*

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: K328*

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102560
AA Change: K328*

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: K328*

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112008
AA Change: K328*

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: K328*

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000141101
AA Change: K328*

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: K328*

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,471,429	V351A	possibly damaging	Het
Abcc6	A	G	7: 45,995,237	L838P	probably damaging	Het
Adgrl4	T	A	3: 151,543,258	F728I	probably damaging	Het
Asap1	A	G	15: 64,312,455	V7A	probably benign	Het
B230104I21Rik	A	G	4: 154,349,593		probably benign	Het
C4b	A	T	17: 34,739,675	S562T	probably benign	Het
Carmil2	A	G	8: 105,695,489	Y1130C	probably damaging	Het
Col18a1	T	C	10: 77,113,303	D125G	unknown	Het
Cxadr	T	C	16: 78,329,108	V122A	probably damaging	Het
Cyp2d22	G	A	15: 82,375,852	P44S	probably damaging	Het
Gabrr1	A	G	4: 33,148,964	T74A	probably benign	Het
Gfm2	C	A	13: 97,172,578	A597E	probably benign	Het
Gm5346	T	G	8: 43,625,244	N648H	probably damaging	Het
H2-T22	T	C	17: 36,040,516	Y274C	probably damaging	Het
Has2	C	A	15: 56,668,421	W299C	probably damaging	Het
Hsd17b6	A	G	10: 127,991,358	S282P	probably benign	Het
Itga1	T	C	13: 114,974,140	I972V	probably benign	Het
Itih5	T	A	2: 10,249,376	Y813N	probably damaging	Het
Kctd16	A	G	18: 40,530,795	T326A	possibly damaging	Het
Klhdc1	T	C	12: 69,269,868	S342P	probably damaging	Het
Kmt2a	T	C	9: 44,831,353	I1682M	unknown	Het
Lamc1	T	C	1: 153,240,454	K994E	possibly damaging	Het
Lig1	T	G	7: 13,296,344	S416A	probably benign	Het
Lims1	A	G	10: 58,412,441	E240G	probably damaging	Het
Lnpk	T	C	2: 74,568,972	M76V	probably benign	Het
Lrrtm4	T	A	6: 80,022,445	L280*	probably null	Het
Mfap3l	A	T	8: 60,671,281	I186F	possibly damaging	Het
Mta3	T	C	17: 83,775,582	F234L	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mybpc2	C	T	7: 44,509,799	G609D	probably damaging	Het
Naga	A	T	15: 82,334,834	D237E	probably benign	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nbn	G	A	4: 15,963,911	S104N	probably damaging	Het
Nipsnap2	T	C	5: 129,739,573	L60P	probably damaging	Het
Olfr1317	T	A	2: 112,142,580	F212I	probably benign	Het
Olfr904	G	A	9: 38,464,506	G155D	probably benign	Het
Pclo	C	T	5: 14,677,587	T2153I	unknown	Het
Pclo	A	C	5: 14,858,855	K5059T	unknown	Het
Pdlim2	C	A	14: 70,166,196	A256S	possibly damaging	Het
Pira2	T	C	7: 3,842,461	D308G	probably damaging	Het
Proc	G	T	18: 32,123,636	A326E	probably damaging	Het
Rab40b	T	C	11: 121,357,883	D182G	probably benign	Het
Rai14	A	G	15: 10,574,851	S703P	possibly damaging	Het
Rdx	C	T	9: 52,060,896	P2L	possibly damaging	Het
Recql5	T	C	11: 115,928,381	K120E	probably benign	Het
Rev3l	C	T	10: 39,822,884	R1126C	probably damaging	Het
Slc2a6	G	T	2: 27,027,183	D70E	possibly damaging	Het
Slc6a17	A	T	3: 107,471,352	D671E	possibly damaging	Het
Slc7a8	G	A	14: 54,781,400		probably benign	Het
Srpk2	A	G	5: 23,548,519	Y79H	possibly damaging	Het
Traf3ip1	T	A	1: 91,511,445	I361K	probably damaging	Het
Trpm8	A	G	1: 88,328,196	Y191C	probably damaging	Het
Ubr3	T	C	2: 69,973,468	V1135A	possibly damaging	Het
Usp12	C	A	5: 146,754,369		probably null	Het
Vmn1r44	C	A	6: 89,893,836	P188Q	probably benign	Het
Xirp2	T	A	2: 67,525,755	V3620D	possibly damaging	Het
Zcchc14	A	T	8: 121,608,500	S294T	unknown	Het
Zfp800	T	C	6: 28,260,765	D5G	probably damaging	Het
Zfp87	C	T	13: 67,517,293	R350Q	probably benign	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCCATTGATGTGAACAG -3'
(R):5'- TGGCTGTAAATAATTGAAGGCCC -3'

Sequencing Primer
(F):5'- CTGGAACATGCCTTTGGTCTAAAG -3'
(R):5'- AATAATTGAAGGCCCTCTTTCGTTC -3'

Posted On

2019-10-24