Incidental Mutation 'R7597:Abcc6'
ID 587785
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45995237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 838 (L838P)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: L838P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: L838P

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGTATGGTTAAGTACTGCAC -3'
(R):5'- AGCCCACATCTTCTAAATTTGC -3'

Sequencing Primer
(F):5'- GTACTGCACTCACATCAGTGG -3'
(R):5'- TATAGTAGTCTCCAGAAGAAGTGC -3'
Posted On 2019-10-24