Mutagenetix > Incidental Mutation

Incidental Mutation 'R7597:Gm5346'

587786

Institutional Source

Beutler Lab

Gene Symbol

Gm5346

Ensembl Gene

ENSMUSG00000050190

Gene Name

predicted gene 5346

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R7597 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43624951-43627276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 43625244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 648 (N648H)

Ref Sequence

ENSEMBL: ENSMUSP00000058858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056023]

AlphaFold

Q7M766

Predicted Effect

probably damaging
Transcript: ENSMUST00000056023
AA Change: N648H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: N648H

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	159	1.3e-18	PFAM
Pfam:Reprolysin_5	205	384	1.1e-15	PFAM
Pfam:Reprolysin_4	205	393	6.2e-9	PFAM
Pfam:Reprolysin	207	397	1.7e-46	PFAM
Pfam:Reprolysin_2	223	389	5.7e-14	PFAM
Pfam:Reprolysin_3	231	352	2.6e-13	PFAM
DISIN	416	491	2.48e-38	SMART
ACR	492	628	3.4e-65	SMART
EGF	634	664	2.69e1	SMART
transmembrane domain	685	707	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,471,429	V351A	possibly damaging	Het
Abcc6	A	G	7: 45,995,237	L838P	probably damaging	Het
Adgrl4	T	A	3: 151,543,258	F728I	probably damaging	Het
Asap1	A	G	15: 64,312,455	V7A	probably benign	Het
B230104I21Rik	A	G	4: 154,349,593		probably benign	Het
C4b	A	T	17: 34,739,675	S562T	probably benign	Het
Carmil2	A	G	8: 105,695,489	Y1130C	probably damaging	Het
Cit	A	T	5: 115,886,681	K328*	probably null	Het
Col18a1	T	C	10: 77,113,303	D125G	unknown	Het
Cxadr	T	C	16: 78,329,108	V122A	probably damaging	Het
Cyp2d22	G	A	15: 82,375,852	P44S	probably damaging	Het
Gabrr1	A	G	4: 33,148,964	T74A	probably benign	Het
Gfm2	C	A	13: 97,172,578	A597E	probably benign	Het
H2-T22	T	C	17: 36,040,516	Y274C	probably damaging	Het
Has2	C	A	15: 56,668,421	W299C	probably damaging	Het
Hsd17b6	A	G	10: 127,991,358	S282P	probably benign	Het
Itga1	T	C	13: 114,974,140	I972V	probably benign	Het
Itih5	T	A	2: 10,249,376	Y813N	probably damaging	Het
Kctd16	A	G	18: 40,530,795	T326A	possibly damaging	Het
Klhdc1	T	C	12: 69,269,868	S342P	probably damaging	Het
Kmt2a	T	C	9: 44,831,353	I1682M	unknown	Het
Lamc1	T	C	1: 153,240,454	K994E	possibly damaging	Het
Lig1	T	G	7: 13,296,344	S416A	probably benign	Het
Lims1	A	G	10: 58,412,441	E240G	probably damaging	Het
Lnpk	T	C	2: 74,568,972	M76V	probably benign	Het
Lrrtm4	T	A	6: 80,022,445	L280*	probably null	Het
Mfap3l	A	T	8: 60,671,281	I186F	possibly damaging	Het
Mta3	T	C	17: 83,775,582	F234L	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mybpc2	C	T	7: 44,509,799	G609D	probably damaging	Het
Naga	A	T	15: 82,334,834	D237E	probably benign	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nbn	G	A	4: 15,963,911	S104N	probably damaging	Het
Nipsnap2	T	C	5: 129,739,573	L60P	probably damaging	Het
Olfr1317	T	A	2: 112,142,580	F212I	probably benign	Het
Olfr904	G	A	9: 38,464,506	G155D	probably benign	Het
Pclo	C	T	5: 14,677,587	T2153I	unknown	Het
Pclo	A	C	5: 14,858,855	K5059T	unknown	Het
Pdlim2	C	A	14: 70,166,196	A256S	possibly damaging	Het
Pira2	T	C	7: 3,842,461	D308G	probably damaging	Het
Proc	G	T	18: 32,123,636	A326E	probably damaging	Het
Rab40b	T	C	11: 121,357,883	D182G	probably benign	Het
Rai14	A	G	15: 10,574,851	S703P	possibly damaging	Het
Rdx	C	T	9: 52,060,896	P2L	possibly damaging	Het
Recql5	T	C	11: 115,928,381	K120E	probably benign	Het
Rev3l	C	T	10: 39,822,884	R1126C	probably damaging	Het
Slc2a6	G	T	2: 27,027,183	D70E	possibly damaging	Het
Slc6a17	A	T	3: 107,471,352	D671E	possibly damaging	Het
Slc7a8	G	A	14: 54,781,400		probably benign	Het
Srpk2	A	G	5: 23,548,519	Y79H	possibly damaging	Het
Traf3ip1	T	A	1: 91,511,445	I361K	probably damaging	Het
Trpm8	A	G	1: 88,328,196	Y191C	probably damaging	Het
Ubr3	T	C	2: 69,973,468	V1135A	possibly damaging	Het
Usp12	C	A	5: 146,754,369		probably null	Het
Vmn1r44	C	A	6: 89,893,836	P188Q	probably benign	Het
Xirp2	T	A	2: 67,525,755	V3620D	possibly damaging	Het
Zcchc14	A	T	8: 121,608,500	S294T	unknown	Het
Zfp800	T	C	6: 28,260,765	D5G	probably damaging	Het
Zfp87	C	T	13: 67,517,293	R350Q	probably benign	Het

Other mutations in Gm5346

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Gm5346	APN	8	43625381	missense	probably benign	0.12
IGL00391:Gm5346	APN	8	43625629	missense	probably damaging	1.00
IGL00422:Gm5346	APN	8	43626351	missense	probably damaging	1.00
IGL00664:Gm5346	APN	8	43625969	missense	probably benign
IGL01095:Gm5346	APN	8	43626096	missense	probably benign	0.22
IGL01113:Gm5346	APN	8	43626152	missense	probably damaging	1.00
IGL01444:Gm5346	APN	8	43626433	missense	probably benign	0.06
IGL01782:Gm5346	APN	8	43626735	missense	probably benign	0.01
IGL01921:Gm5346	APN	8	43625511	missense	probably damaging	0.96
IGL01964:Gm5346	APN	8	43626761	missense	probably benign	0.00
IGL02139:Gm5346	APN	8	43625578	missense	probably benign	0.01
IGL02555:Gm5346	APN	8	43625268	missense	probably damaging	1.00
IGL02951:Gm5346	APN	8	43627088	missense	possibly damaging	0.62
R0056:Gm5346	UTSW	8	43625503	nonsense	probably null
R0218:Gm5346	UTSW	8	43626440	missense	probably benign	0.00
R0530:Gm5346	UTSW	8	43626531	missense	probably benign	0.00
R0925:Gm5346	UTSW	8	43626303	missense	probably benign	0.11
R0927:Gm5346	UTSW	8	43625123	missense	probably benign	0.00
R0975:Gm5346	UTSW	8	43625118	missense	probably benign
R1300:Gm5346	UTSW	8	43626844	nonsense	probably null
R1728:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1729:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1801:Gm5346	UTSW	8	43625917	nonsense	probably null
R1869:Gm5346	UTSW	8	43625095	nonsense	probably null
R1870:Gm5346	UTSW	8	43625095	nonsense	probably null
R1871:Gm5346	UTSW	8	43625095	nonsense	probably null
R1992:Gm5346	UTSW	8	43627139	missense	probably benign	0.44
R2008:Gm5346	UTSW	8	43627037	missense	probably benign	0.00
R2013:Gm5346	UTSW	8	43626405	missense	possibly damaging	0.81
R2022:Gm5346	UTSW	8	43625917	nonsense	probably null
R2175:Gm5346	UTSW	8	43625438	missense	probably benign
R2875:Gm5346	UTSW	8	43627140	nonsense	probably null
R3406:Gm5346	UTSW	8	43626052	nonsense	probably null
R3845:Gm5346	UTSW	8	43626632	missense	probably benign	0.00
R4033:Gm5346	UTSW	8	43626673	missense	probably benign	0.28
R4072:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4074:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4075:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4076:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4153:Gm5346	UTSW	8	43626527	missense	probably benign	0.04
R4330:Gm5346	UTSW	8	43626250	missense	probably benign
R4612:Gm5346	UTSW	8	43626550	missense	probably benign	0.09
R4662:Gm5346	UTSW	8	43627079	missense	probably benign	0.26
R5032:Gm5346	UTSW	8	43626471	missense	probably damaging	1.00
R5077:Gm5346	UTSW	8	43627163	missense	possibly damaging	0.79
R5504:Gm5346	UTSW	8	43625282	missense	probably damaging	1.00
R5697:Gm5346	UTSW	8	43626579	missense	probably damaging	1.00
R6232:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6233:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6234:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6235:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6241:Gm5346	UTSW	8	43626096	missense	probably benign	0.22
R6392:Gm5346	UTSW	8	43626001	missense	probably benign	0.09
R6439:Gm5346	UTSW	8	43625951	missense	probably damaging	1.00
R6454:Gm5346	UTSW	8	43626808	missense	probably damaging	0.96
R6455:Gm5346	UTSW	8	43626152	missense	probably damaging	1.00
R6767:Gm5346	UTSW	8	43626914	missense	probably damaging	1.00
R6774:Gm5346	UTSW	8	43625183	missense	probably benign	0.00
R6877:Gm5346	UTSW	8	43625237	missense	probably benign	0.02
R6911:Gm5346	UTSW	8	43625109	missense	probably benign	0.02
R7211:Gm5346	UTSW	8	43625877	missense	probably damaging	1.00
R7602:Gm5346	UTSW	8	43626666	missense	probably damaging	0.99
R7797:Gm5346	UTSW	8	43626374	missense	probably benign	0.04
R7981:Gm5346	UTSW	8	43625813	missense	probably damaging	1.00
R8154:Gm5346	UTSW	8	43625387	missense	probably damaging	0.97
R8215:Gm5346	UTSW	8	43626501	missense	probably benign	0.05
R9180:Gm5346	UTSW	8	43626933	nonsense	probably null
R9307:Gm5346	UTSW	8	43626267	missense	probably benign	0.00
R9733:Gm5346	UTSW	8	43626149	missense	possibly damaging	0.94
RF001:Gm5346	UTSW	8	43626905	missense	possibly damaging	0.79
Z1177:Gm5346	UTSW	8	43626546	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCTGGCACCGATTCTTTTAGG -3'
(R):5'- TAACACCTGCTGGACGATGG -3'

Sequencing Primer
(F):5'- TTCCTTAATTCACGAATGCCATAC -3'
(R):5'- CGATGGACTATCATTTTGGGATCACC -3'

Posted On

2019-10-24