Incidental Mutation 'R7597:Or8b1b'
ID 587790
Institutional Source Beutler Lab
Gene Symbol Or8b1b
Ensembl Gene ENSMUSG00000094380
Gene Name olfactory receptor family 8 subfamily B member 1B
Synonyms Olfr904, MOR167-3, GA_x6K02T2PVTD-32156773-32157705
MMRRC Submission 045672-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 38375330-38378952 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38375802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 155 (G155D)
Ref Sequence ENSEMBL: ENSMUSP00000150057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058153] [ENSMUST00000216724]
AlphaFold Q7TRC9
Predicted Effect probably benign
Transcript: ENSMUST00000058153
AA Change: G155D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057148
Gene: ENSMUSG00000094380
AA Change: G155D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-51 PFAM
Pfam:7tm_1 41 291 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216724
AA Change: G155D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,644,661 (GRCm39) L838P probably damaging Het
Adam34l T G 8: 44,078,281 (GRCm39) N648H probably damaging Het
Adgrl4 T A 3: 151,248,895 (GRCm39) F728I probably damaging Het
Asap1 A G 15: 64,184,304 (GRCm39) V7A probably benign Het
B230104I21Rik A G 4: 154,434,050 (GRCm39) probably benign Het
C4b A T 17: 34,958,649 (GRCm39) S562T probably benign Het
Carmil2 A G 8: 106,422,121 (GRCm39) Y1130C probably damaging Het
Cit A T 5: 116,024,740 (GRCm39) K328* probably null Het
Col18a1 T C 10: 76,949,137 (GRCm39) D125G unknown Het
Cxadr T C 16: 78,125,996 (GRCm39) V122A probably damaging Het
Cyp2d22 G A 15: 82,260,053 (GRCm39) P44S probably damaging Het
Elapor1 A G 3: 108,378,745 (GRCm39) V351A possibly damaging Het
Gabrr1 A G 4: 33,148,964 (GRCm39) T74A probably benign Het
Gfm2 C A 13: 97,309,086 (GRCm39) A597E probably benign Het
H2-T22 T C 17: 36,351,408 (GRCm39) Y274C probably damaging Het
Has2 C A 15: 56,531,817 (GRCm39) W299C probably damaging Het
Hsd17b6 A G 10: 127,827,227 (GRCm39) S282P probably benign Het
Itga1 T C 13: 115,110,676 (GRCm39) I972V probably benign Het
Itih5 T A 2: 10,254,187 (GRCm39) Y813N probably damaging Het
Kctd16 A G 18: 40,663,848 (GRCm39) T326A possibly damaging Het
Klhdc1 T C 12: 69,316,642 (GRCm39) S342P probably damaging Het
Kmt2a T C 9: 44,742,650 (GRCm39) I1682M unknown Het
Lamc1 T C 1: 153,116,200 (GRCm39) K994E possibly damaging Het
Lig1 T G 7: 13,030,270 (GRCm39) S416A probably benign Het
Lims1 A G 10: 58,248,263 (GRCm39) E240G probably damaging Het
Lnpk T C 2: 74,399,316 (GRCm39) M76V probably benign Het
Lrrtm4 T A 6: 79,999,428 (GRCm39) L280* probably null Het
Mfap3l A T 8: 61,124,315 (GRCm39) I186F possibly damaging Het
Mta3 T C 17: 84,083,011 (GRCm39) F234L probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mybpc2 C T 7: 44,159,223 (GRCm39) G609D probably damaging Het
Naga A T 15: 82,219,035 (GRCm39) D237E probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nipsnap2 T C 5: 129,816,637 (GRCm39) L60P probably damaging Het
Or4f47 T A 2: 111,972,925 (GRCm39) F212I probably benign Het
Pclo C T 5: 14,727,601 (GRCm39) T2153I unknown Het
Pclo A C 5: 14,908,869 (GRCm39) K5059T unknown Het
Pdlim2 C A 14: 70,403,645 (GRCm39) A256S possibly damaging Het
Pira2 T C 7: 3,845,460 (GRCm39) D308G probably damaging Het
Proc G T 18: 32,256,689 (GRCm39) A326E probably damaging Het
Rab40b T C 11: 121,248,709 (GRCm39) D182G probably benign Het
Rai14 A G 15: 10,574,937 (GRCm39) S703P possibly damaging Het
Rdx C T 9: 51,972,196 (GRCm39) P2L possibly damaging Het
Recql5 T C 11: 115,819,207 (GRCm39) K120E probably benign Het
Rev3l C T 10: 39,698,880 (GRCm39) R1126C probably damaging Het
Slc2a6 G T 2: 26,917,195 (GRCm39) D70E possibly damaging Het
Slc6a17 A T 3: 107,378,668 (GRCm39) D671E possibly damaging Het
Slc7a8 G A 14: 55,018,857 (GRCm39) probably benign Het
Srpk2 A G 5: 23,753,517 (GRCm39) Y79H possibly damaging Het
Traf3ip1 T A 1: 91,439,167 (GRCm39) I361K probably damaging Het
Trpm8 A G 1: 88,255,918 (GRCm39) Y191C probably damaging Het
Ubr3 T C 2: 69,803,812 (GRCm39) V1135A possibly damaging Het
Usp12 C A 5: 146,691,179 (GRCm39) probably null Het
Vmn1r44 C A 6: 89,870,818 (GRCm39) P188Q probably benign Het
Xirp2 T A 2: 67,356,099 (GRCm39) V3620D possibly damaging Het
Zcchc14 A T 8: 122,335,239 (GRCm39) S294T unknown Het
Zfp800 T C 6: 28,260,764 (GRCm39) D5G probably damaging Het
Zfp87 C T 13: 67,665,412 (GRCm39) R350Q probably benign Het
Other mutations in Or8b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Or8b1b APN 9 38,376,030 (GRCm39) missense probably benign
IGL01966:Or8b1b APN 9 38,376,225 (GRCm39) missense possibly damaging 0.82
IGL02328:Or8b1b APN 9 38,375,972 (GRCm39) missense probably benign
IGL03394:Or8b1b APN 9 38,375,517 (GRCm39) missense probably damaging 1.00
R0085:Or8b1b UTSW 9 38,375,958 (GRCm39) missense probably benign 0.37
R0125:Or8b1b UTSW 9 38,375,757 (GRCm39) nonsense probably null
R1506:Or8b1b UTSW 9 38,375,439 (GRCm39) missense probably benign 0.02
R1545:Or8b1b UTSW 9 38,375,815 (GRCm39) missense probably benign 0.37
R1610:Or8b1b UTSW 9 38,375,927 (GRCm39) missense probably damaging 0.97
R2008:Or8b1b UTSW 9 38,375,537 (GRCm39) missense probably damaging 1.00
R2424:Or8b1b UTSW 9 38,376,128 (GRCm39) missense probably damaging 0.99
R3824:Or8b1b UTSW 9 38,375,822 (GRCm39) missense probably benign 0.13
R3964:Or8b1b UTSW 9 38,375,979 (GRCm39) missense probably benign 0.25
R4093:Or8b1b UTSW 9 38,375,379 (GRCm39) missense probably null 1.00
R4454:Or8b1b UTSW 9 38,375,938 (GRCm39) missense probably benign 0.03
R5650:Or8b1b UTSW 9 38,376,023 (GRCm39) nonsense probably null
R6921:Or8b1b UTSW 9 38,375,543 (GRCm39) missense probably benign 0.01
R7406:Or8b1b UTSW 9 38,375,439 (GRCm39) missense possibly damaging 0.88
R7959:Or8b1b UTSW 9 38,376,211 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATGTTTAACCCAGCTATATTTC -3'
(R):5'- TGGACCTGCCTTCATTGGAC -3'

Sequencing Primer
(F):5'- GTTTAACCCAGCTATATTTCTTCTGC -3'
(R):5'- GACCTGCCTTCATTGGACTTGATG -3'
Posted On 2019-10-24