Incidental Mutation 'R7597:Zfp87'
ID 587800
Institutional Source Beutler Lab
Gene Symbol Zfp87
Ensembl Gene ENSMUSG00000097333
Gene Name zinc finger protein 87
Synonyms Mzf22, 2210039O17Rik, 4631412O18Rik, Zfp72, KRAB4
MMRRC Submission 045672-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 67663900-67674296 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67665412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 350 (R350Q)
Ref Sequence ENSEMBL: ENSMUSP00000138087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167914] [ENSMUST00000180536] [ENSMUST00000181341] [ENSMUST00000181573] [ENSMUST00000181767]
AlphaFold Q8K2A4
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180536
SMART Domains Protein: ENSMUSP00000137812
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181341
SMART Domains Protein: ENSMUSP00000137689
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181573
SMART Domains Protein: ENSMUSP00000138011
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181767
AA Change: R350Q

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138087
Gene: ENSMUSG00000097333
AA Change: R350Q

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
ZnF_C2H2 109 131 2.61e-4 SMART
ZnF_C2H2 137 159 9.22e-5 SMART
ZnF_C2H2 165 187 2.36e-2 SMART
ZnF_C2H2 193 215 7.15e-2 SMART
ZnF_C2H2 221 243 9.22e-5 SMART
ZnF_C2H2 249 271 3.63e-3 SMART
ZnF_C2H2 277 299 6.42e-4 SMART
ZnF_C2H2 305 327 2.99e-4 SMART
ZnF_C2H2 333 355 2.4e-3 SMART
ZnF_C2H2 361 383 5.59e-4 SMART
ZnF_C2H2 389 411 3.69e-4 SMART
ZnF_C2H2 417 439 5.9e-3 SMART
ZnF_C2H2 445 467 3.21e-4 SMART
ZnF_C2H2 472 494 9.08e-4 SMART
ZnF_C2H2 500 522 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,644,661 (GRCm39) L838P probably damaging Het
Adam34l T G 8: 44,078,281 (GRCm39) N648H probably damaging Het
Adgrl4 T A 3: 151,248,895 (GRCm39) F728I probably damaging Het
Asap1 A G 15: 64,184,304 (GRCm39) V7A probably benign Het
B230104I21Rik A G 4: 154,434,050 (GRCm39) probably benign Het
C4b A T 17: 34,958,649 (GRCm39) S562T probably benign Het
Carmil2 A G 8: 106,422,121 (GRCm39) Y1130C probably damaging Het
Cit A T 5: 116,024,740 (GRCm39) K328* probably null Het
Col18a1 T C 10: 76,949,137 (GRCm39) D125G unknown Het
Cxadr T C 16: 78,125,996 (GRCm39) V122A probably damaging Het
Cyp2d22 G A 15: 82,260,053 (GRCm39) P44S probably damaging Het
Elapor1 A G 3: 108,378,745 (GRCm39) V351A possibly damaging Het
Gabrr1 A G 4: 33,148,964 (GRCm39) T74A probably benign Het
Gfm2 C A 13: 97,309,086 (GRCm39) A597E probably benign Het
H2-T22 T C 17: 36,351,408 (GRCm39) Y274C probably damaging Het
Has2 C A 15: 56,531,817 (GRCm39) W299C probably damaging Het
Hsd17b6 A G 10: 127,827,227 (GRCm39) S282P probably benign Het
Itga1 T C 13: 115,110,676 (GRCm39) I972V probably benign Het
Itih5 T A 2: 10,254,187 (GRCm39) Y813N probably damaging Het
Kctd16 A G 18: 40,663,848 (GRCm39) T326A possibly damaging Het
Klhdc1 T C 12: 69,316,642 (GRCm39) S342P probably damaging Het
Kmt2a T C 9: 44,742,650 (GRCm39) I1682M unknown Het
Lamc1 T C 1: 153,116,200 (GRCm39) K994E possibly damaging Het
Lig1 T G 7: 13,030,270 (GRCm39) S416A probably benign Het
Lims1 A G 10: 58,248,263 (GRCm39) E240G probably damaging Het
Lnpk T C 2: 74,399,316 (GRCm39) M76V probably benign Het
Lrrtm4 T A 6: 79,999,428 (GRCm39) L280* probably null Het
Mfap3l A T 8: 61,124,315 (GRCm39) I186F possibly damaging Het
Mta3 T C 17: 84,083,011 (GRCm39) F234L probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mybpc2 C T 7: 44,159,223 (GRCm39) G609D probably damaging Het
Naga A T 15: 82,219,035 (GRCm39) D237E probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nipsnap2 T C 5: 129,816,637 (GRCm39) L60P probably damaging Het
Or4f47 T A 2: 111,972,925 (GRCm39) F212I probably benign Het
Or8b1b G A 9: 38,375,802 (GRCm39) G155D probably benign Het
Pclo C T 5: 14,727,601 (GRCm39) T2153I unknown Het
Pclo A C 5: 14,908,869 (GRCm39) K5059T unknown Het
Pdlim2 C A 14: 70,403,645 (GRCm39) A256S possibly damaging Het
Pira2 T C 7: 3,845,460 (GRCm39) D308G probably damaging Het
Proc G T 18: 32,256,689 (GRCm39) A326E probably damaging Het
Rab40b T C 11: 121,248,709 (GRCm39) D182G probably benign Het
Rai14 A G 15: 10,574,937 (GRCm39) S703P possibly damaging Het
Rdx C T 9: 51,972,196 (GRCm39) P2L possibly damaging Het
Recql5 T C 11: 115,819,207 (GRCm39) K120E probably benign Het
Rev3l C T 10: 39,698,880 (GRCm39) R1126C probably damaging Het
Slc2a6 G T 2: 26,917,195 (GRCm39) D70E possibly damaging Het
Slc6a17 A T 3: 107,378,668 (GRCm39) D671E possibly damaging Het
Slc7a8 G A 14: 55,018,857 (GRCm39) probably benign Het
Srpk2 A G 5: 23,753,517 (GRCm39) Y79H possibly damaging Het
Traf3ip1 T A 1: 91,439,167 (GRCm39) I361K probably damaging Het
Trpm8 A G 1: 88,255,918 (GRCm39) Y191C probably damaging Het
Ubr3 T C 2: 69,803,812 (GRCm39) V1135A possibly damaging Het
Usp12 C A 5: 146,691,179 (GRCm39) probably null Het
Vmn1r44 C A 6: 89,870,818 (GRCm39) P188Q probably benign Het
Xirp2 T A 2: 67,356,099 (GRCm39) V3620D possibly damaging Het
Zcchc14 A T 8: 122,335,239 (GRCm39) S294T unknown Het
Zfp800 T C 6: 28,260,764 (GRCm39) D5G probably damaging Het
Other mutations in Zfp87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp87 APN 13 67,665,989 (GRCm39) missense probably damaging 0.99
IGL02372:Zfp87 APN 13 67,668,739 (GRCm39) splice site probably benign
IGL03160:Zfp87 APN 13 67,669,392 (GRCm39) missense probably damaging 1.00
R0653:Zfp87 UTSW 13 74,520,190 (GRCm39) missense probably damaging 1.00
R0711:Zfp87 UTSW 13 74,524,544 (GRCm39) splice site probably benign
R1498:Zfp87 UTSW 13 74,520,736 (GRCm39) missense probably benign 0.01
R3801:Zfp87 UTSW 13 67,669,334 (GRCm39) missense probably damaging 1.00
R4032:Zfp87 UTSW 13 74,520,449 (GRCm39) missense possibly damaging 0.62
R4629:Zfp87 UTSW 13 74,520,512 (GRCm39) missense probably damaging 1.00
R4950:Zfp87 UTSW 13 67,666,018 (GRCm39) missense probably benign 0.20
R5604:Zfp87 UTSW 13 67,665,945 (GRCm39) missense probably damaging 1.00
R6111:Zfp87 UTSW 13 74,520,504 (GRCm39) missense probably benign 0.31
R6130:Zfp87 UTSW 13 74,520,460 (GRCm39) missense possibly damaging 0.75
R6277:Zfp87 UTSW 13 74,520,643 (GRCm39) nonsense probably null
R6392:Zfp87 UTSW 13 67,664,986 (GRCm39) missense probably benign 0.00
R6800:Zfp87 UTSW 13 74,520,080 (GRCm39) missense probably benign 0.00
R6909:Zfp87 UTSW 13 74,519,861 (GRCm39) missense possibly damaging 0.47
R7009:Zfp87 UTSW 13 67,665,173 (GRCm39) missense probably damaging 1.00
R7183:Zfp87 UTSW 13 67,665,593 (GRCm39) missense probably damaging 1.00
R7298:Zfp87 UTSW 13 74,520,513 (GRCm39) missense possibly damaging 0.93
R7330:Zfp87 UTSW 13 74,523,153 (GRCm39) missense probably damaging 0.99
R7341:Zfp87 UTSW 13 74,520,467 (GRCm39) missense possibly damaging 0.68
R7448:Zfp87 UTSW 13 67,665,163 (GRCm39) missense probably benign 0.01
R8696:Zfp87 UTSW 13 74,520,599 (GRCm39) missense probably damaging 1.00
R9280:Zfp87 UTSW 13 74,520,803 (GRCm39) missense probably benign 0.16
R9429:Zfp87 UTSW 13 74,520,703 (GRCm39) missense probably damaging 1.00
R9780:Zfp87 UTSW 13 67,665,241 (GRCm39) missense probably damaging 1.00
R9782:Zfp87 UTSW 13 74,520,932 (GRCm39) missense probably benign 0.00
RF014:Zfp87 UTSW 13 74,523,173 (GRCm39) missense probably benign 0.17
Z1176:Zfp87 UTSW 13 67,674,275 (GRCm39) start gained probably benign
Z1177:Zfp87 UTSW 13 74,519,911 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTCATAAGGTAGGAGTGAG -3'
(R):5'- TCGTTCAAACCTGAAGGGACATC -3'

Sequencing Primer
(F):5'- AGAGCTTCACTTCAGCATGG -3'
(R):5'- GGGACATCAGATTATTCATTCTGGAG -3'
Posted On 2019-10-24