Incidental Mutation 'R7597:Zfp87'
ID587800
Institutional Source Beutler Lab
Gene Symbol Zfp87
Ensembl Gene ENSMUSG00000097333
Gene Namezinc finger protein 87
SynonymsMzf22, 2210039O17Rik, Zfp72, KRAB4, 4631412O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67515781-67526177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67517293 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 350 (R350Q)
Ref Sequence ENSEMBL: ENSMUSP00000138087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167914] [ENSMUST00000180536] [ENSMUST00000181341] [ENSMUST00000181573] [ENSMUST00000181767]
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180536
SMART Domains Protein: ENSMUSP00000137812
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181341
SMART Domains Protein: ENSMUSP00000137689
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181573
SMART Domains Protein: ENSMUSP00000138011
Gene: ENSMUSG00000097333

DomainStartEndE-ValueType
KRAB 5 51 7.02e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181767
AA Change: R350Q

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138087
Gene: ENSMUSG00000097333
AA Change: R350Q

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
ZnF_C2H2 109 131 2.61e-4 SMART
ZnF_C2H2 137 159 9.22e-5 SMART
ZnF_C2H2 165 187 2.36e-2 SMART
ZnF_C2H2 193 215 7.15e-2 SMART
ZnF_C2H2 221 243 9.22e-5 SMART
ZnF_C2H2 249 271 3.63e-3 SMART
ZnF_C2H2 277 299 6.42e-4 SMART
ZnF_C2H2 305 327 2.99e-4 SMART
ZnF_C2H2 333 355 2.4e-3 SMART
ZnF_C2H2 361 383 5.59e-4 SMART
ZnF_C2H2 389 411 3.69e-4 SMART
ZnF_C2H2 417 439 5.9e-3 SMART
ZnF_C2H2 445 467 3.21e-4 SMART
ZnF_C2H2 472 494 9.08e-4 SMART
ZnF_C2H2 500 522 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Other mutations in Zfp87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Zfp87 APN 13 67517870 missense probably damaging 0.99
IGL02372:Zfp87 APN 13 67520620 splice site probably benign
IGL03160:Zfp87 APN 13 67521273 missense probably damaging 1.00
R3801:Zfp87 UTSW 13 67521215 missense probably damaging 1.00
R4950:Zfp87 UTSW 13 67517899 missense probably benign 0.20
R5604:Zfp87 UTSW 13 67517826 missense probably damaging 1.00
R6392:Zfp87 UTSW 13 67516867 missense probably benign 0.00
R7009:Zfp87 UTSW 13 67517054 missense probably damaging 1.00
R7183:Zfp87 UTSW 13 67517474 missense probably damaging 1.00
R7448:Zfp87 UTSW 13 67517044 missense probably benign 0.01
Z1176:Zfp87 UTSW 13 67526156 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTCATAAGGTAGGAGTGAG -3'
(R):5'- TCGTTCAAACCTGAAGGGACATC -3'

Sequencing Primer
(F):5'- AGAGCTTCACTTCAGCATGG -3'
(R):5'- GGGACATCAGATTATTCATTCTGGAG -3'
Posted On2019-10-24