Incidental Mutation 'R7597:Itga1'
ID587803
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114974140 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 972 (I972V)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: I972V

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: I972V

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTTAGCCTGAAGGTCTAGAAGTG -3'
(R):5'- GGGGTGTAAAAGAATCACTCTCTG -3'

Sequencing Primer
(F):5'- GCCTGAAGGTCTAGAAGTGATTATC -3'
(R):5'- GAATCACTCTCTGTTTTGAAGTCTAC -3'
Posted On2019-10-24