Mutagenetix > Incidental Mutation

Incidental Mutation 'R7597:Pdlim2'

587805

Institutional Source

Beutler Lab

Gene Symbol

Pdlim2

Ensembl Gene

ENSMUSG00000022090

Gene Name

PDZ and LIM domain 2

Synonyms

SLIM, 4732462F18Rik, mystique

MMRRC Submission

045672-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R7597 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70164218-70177681 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70166196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 256 (A256S)

Ref Sequence

ENSEMBL: ENSMUSP00000022681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]

AlphaFold

Q8R1G6

PDB Structure

Solution structure of the PDZ domain of PDZ and LIM domain 2 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022681
AA Change: A256S

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: A256S

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
Pfam:DUF4749	169	256	4.4e-12	PFAM
low complexity region	259	271	N/A	INTRINSIC
LIM	282	334	1.25e-6	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: A57S

Domain	Start	End	E-Value	Type
Pfam:DUF4749	7	58	6.4e-13	PFAM
low complexity region	61	73	N/A	INTRINSIC
LIM	84	136	1.25e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127836
AA Change: A35S

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: A35S

Domain	Start	End	E-Value	Type
low complexity region	20	29	N/A	INTRINSIC
low complexity region	38	50	N/A	INTRINSIC
LIM	61	113	5.9e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129174
AA Change: A35S

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: A35S

Domain	Start	End	E-Value	Type
low complexity region	20	29	N/A	INTRINSIC
low complexity region	38	50	N/A	INTRINSIC
LIM	61	113	5.9e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143393

SMART Domains

Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153735
AA Change: A256S

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: A256S

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC
low complexity region	241	250	N/A	INTRINSIC
low complexity region	259	271	N/A	INTRINSIC
LIM	282	334	1.25e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,471,429	V351A	possibly damaging	Het
Abcc6	A	G	7: 45,995,237	L838P	probably damaging	Het
Adgrl4	T	A	3: 151,543,258	F728I	probably damaging	Het
Asap1	A	G	15: 64,312,455	V7A	probably benign	Het
B230104I21Rik	A	G	4: 154,349,593		probably benign	Het
C4b	A	T	17: 34,739,675	S562T	probably benign	Het
Carmil2	A	G	8: 105,695,489	Y1130C	probably damaging	Het
Cit	A	T	5: 115,886,681	K328*	probably null	Het
Col18a1	T	C	10: 77,113,303	D125G	unknown	Het
Cxadr	T	C	16: 78,329,108	V122A	probably damaging	Het
Cyp2d22	G	A	15: 82,375,852	P44S	probably damaging	Het
Gabrr1	A	G	4: 33,148,964	T74A	probably benign	Het
Gfm2	C	A	13: 97,172,578	A597E	probably benign	Het
Gm5346	T	G	8: 43,625,244	N648H	probably damaging	Het
H2-T22	T	C	17: 36,040,516	Y274C	probably damaging	Het
Has2	C	A	15: 56,668,421	W299C	probably damaging	Het
Hsd17b6	A	G	10: 127,991,358	S282P	probably benign	Het
Itga1	T	C	13: 114,974,140	I972V	probably benign	Het
Itih5	T	A	2: 10,249,376	Y813N	probably damaging	Het
Kctd16	A	G	18: 40,530,795	T326A	possibly damaging	Het
Klhdc1	T	C	12: 69,269,868	S342P	probably damaging	Het
Kmt2a	T	C	9: 44,831,353	I1682M	unknown	Het
Lamc1	T	C	1: 153,240,454	K994E	possibly damaging	Het
Lig1	T	G	7: 13,296,344	S416A	probably benign	Het
Lims1	A	G	10: 58,412,441	E240G	probably damaging	Het
Lnpk	T	C	2: 74,568,972	M76V	probably benign	Het
Lrrtm4	T	A	6: 80,022,445	L280*	probably null	Het
Mfap3l	A	T	8: 60,671,281	I186F	possibly damaging	Het
Mta3	T	C	17: 83,775,582	F234L	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mybpc2	C	T	7: 44,509,799	G609D	probably damaging	Het
Naga	A	T	15: 82,334,834	D237E	probably benign	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nbn	G	A	4: 15,963,911	S104N	probably damaging	Het
Nipsnap2	T	C	5: 129,739,573	L60P	probably damaging	Het
Olfr1317	T	A	2: 112,142,580	F212I	probably benign	Het
Olfr904	G	A	9: 38,464,506	G155D	probably benign	Het
Pclo	C	T	5: 14,677,587	T2153I	unknown	Het
Pclo	A	C	5: 14,858,855	K5059T	unknown	Het
Pira2	T	C	7: 3,842,461	D308G	probably damaging	Het
Proc	G	T	18: 32,123,636	A326E	probably damaging	Het
Rab40b	T	C	11: 121,357,883	D182G	probably benign	Het
Rai14	A	G	15: 10,574,851	S703P	possibly damaging	Het
Rdx	C	T	9: 52,060,896	P2L	possibly damaging	Het
Recql5	T	C	11: 115,928,381	K120E	probably benign	Het
Rev3l	C	T	10: 39,822,884	R1126C	probably damaging	Het
Slc2a6	G	T	2: 27,027,183	D70E	possibly damaging	Het
Slc6a17	A	T	3: 107,471,352	D671E	possibly damaging	Het
Slc7a8	G	A	14: 54,781,400		probably benign	Het
Srpk2	A	G	5: 23,548,519	Y79H	possibly damaging	Het
Traf3ip1	T	A	1: 91,511,445	I361K	probably damaging	Het
Trpm8	A	G	1: 88,328,196	Y191C	probably damaging	Het
Ubr3	T	C	2: 69,973,468	V1135A	possibly damaging	Het
Usp12	C	A	5: 146,754,369		probably null	Het
Vmn1r44	C	A	6: 89,893,836	P188Q	probably benign	Het
Xirp2	T	A	2: 67,525,755	V3620D	possibly damaging	Het
Zcchc14	A	T	8: 121,608,500	S294T	unknown	Het
Zfp800	T	C	6: 28,260,765	D5G	probably damaging	Het
Zfp87	C	T	13: 67,517,293	R350Q	probably benign	Het

Other mutations in Pdlim2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02295:Pdlim2	APN	14	70166083	splice site	probably benign
IGL02338:Pdlim2	APN	14	70174457	missense	probably damaging	1.00
IGL03286:Pdlim2	APN	14	70174476	missense	possibly damaging	0.88
PIT4504001:Pdlim2	UTSW	14	70166130	missense	probably benign	0.44
R0751:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R0768:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R0832:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1167:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1207:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1207:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1343:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1412:Pdlim2	UTSW	14	70174324	splice site	probably benign
R1595:Pdlim2	UTSW	14	70164744	missense	probably damaging	1.00
R1689:Pdlim2	UTSW	14	70171239	missense	probably damaging	0.98
R1703:Pdlim2	UTSW	14	70174335	critical splice donor site	probably null
R1843:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1845:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1923:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1924:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1925:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2004:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2005:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2202:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2205:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2237:Pdlim2	UTSW	14	70171249	missense	probably benign	0.05
R2843:Pdlim2	UTSW	14	70166100	missense	probably benign	0.02
R4042:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R4965:Pdlim2	UTSW	14	70168015	unclassified	probably benign
R4971:Pdlim2	UTSW	14	70167759	missense	probably damaging	1.00
R5951:Pdlim2	UTSW	14	70167780	missense	probably benign	0.06
R6252:Pdlim2	UTSW	14	70167688	missense	probably damaging	1.00
R7208:Pdlim2	UTSW	14	70174377	missense	probably damaging	1.00
R7627:Pdlim2	UTSW	14	70171475	missense	probably benign
R8342:Pdlim2	UTSW	14	70166114	missense	probably damaging	1.00
R8554:Pdlim2	UTSW	14	70171249	missense	probably benign
R9361:Pdlim2	UTSW	14	70164741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAGGGTCCCTGACTGATG -3'
(R):5'- CTTCATCAGCCTTTGCCAAG -3'

Sequencing Primer
(F):5'- ACTGATGGCCCAGCTTTG -3'
(R):5'- CCTTTACTAAGTGGCATCCCC -3'

Posted On

2019-10-24