Mutagenetix > Incidental Mutation

Incidental Mutation 'R7597:Rai14'

587806

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.396) question?

Stock #

R7597 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10574851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 703 (S703P)

Ref Sequence

ENSEMBL: ENSMUSP00000087815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090339
AA Change: S703P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: S703P

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169385
AA Change: S703P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: S703P

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000227506
AA Change: S674P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	G	3: 108,471,429	V351A	possibly damaging	Het
Abcc6	A	G	7: 45,995,237	L838P	probably damaging	Het
Adgrl4	T	A	3: 151,543,258	F728I	probably damaging	Het
Asap1	A	G	15: 64,312,455	V7A	probably benign	Het
B230104I21Rik	A	G	4: 154,349,593		probably benign	Het
C4b	A	T	17: 34,739,675	S562T	probably benign	Het
Carmil2	A	G	8: 105,695,489	Y1130C	probably damaging	Het
Cit	A	T	5: 115,886,681	K328*	probably null	Het
Col18a1	T	C	10: 77,113,303	D125G	unknown	Het
Cxadr	T	C	16: 78,329,108	V122A	probably damaging	Het
Cyp2d22	G	A	15: 82,375,852	P44S	probably damaging	Het
Gabrr1	A	G	4: 33,148,964	T74A	probably benign	Het
Gfm2	C	A	13: 97,172,578	A597E	probably benign	Het
Gm5346	T	G	8: 43,625,244	N648H	probably damaging	Het
H2-T22	T	C	17: 36,040,516	Y274C	probably damaging	Het
Has2	C	A	15: 56,668,421	W299C	probably damaging	Het
Hsd17b6	A	G	10: 127,991,358	S282P	probably benign	Het
Itga1	T	C	13: 114,974,140	I972V	probably benign	Het
Itih5	T	A	2: 10,249,376	Y813N	probably damaging	Het
Kctd16	A	G	18: 40,530,795	T326A	possibly damaging	Het
Klhdc1	T	C	12: 69,269,868	S342P	probably damaging	Het
Kmt2a	T	C	9: 44,831,353	I1682M	unknown	Het
Lamc1	T	C	1: 153,240,454	K994E	possibly damaging	Het
Lig1	T	G	7: 13,296,344	S416A	probably benign	Het
Lims1	A	G	10: 58,412,441	E240G	probably damaging	Het
Lnpk	T	C	2: 74,568,972	M76V	probably benign	Het
Lrrtm4	T	A	6: 80,022,445	L280*	probably null	Het
Mfap3l	A	T	8: 60,671,281	I186F	possibly damaging	Het
Mta3	T	C	17: 83,775,582	F234L	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mybpc2	C	T	7: 44,509,799	G609D	probably damaging	Het
Naga	A	T	15: 82,334,834	D237E	probably benign	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nbn	G	A	4: 15,963,911	S104N	probably damaging	Het
Nipsnap2	T	C	5: 129,739,573	L60P	probably damaging	Het
Olfr1317	T	A	2: 112,142,580	F212I	probably benign	Het
Olfr904	G	A	9: 38,464,506	G155D	probably benign	Het
Pclo	C	T	5: 14,677,587	T2153I	unknown	Het
Pclo	A	C	5: 14,858,855	K5059T	unknown	Het
Pdlim2	C	A	14: 70,166,196	A256S	possibly damaging	Het
Pira2	T	C	7: 3,842,461	D308G	probably damaging	Het
Proc	G	T	18: 32,123,636	A326E	probably damaging	Het
Rab40b	T	C	11: 121,357,883	D182G	probably benign	Het
Rdx	C	T	9: 52,060,896	P2L	possibly damaging	Het
Recql5	T	C	11: 115,928,381	K120E	probably benign	Het
Rev3l	C	T	10: 39,822,884	R1126C	probably damaging	Het
Slc2a6	G	T	2: 27,027,183	D70E	possibly damaging	Het
Slc6a17	A	T	3: 107,471,352	D671E	possibly damaging	Het
Slc7a8	G	A	14: 54,781,400		probably benign	Het
Srpk2	A	G	5: 23,548,519	Y79H	possibly damaging	Het
Traf3ip1	T	A	1: 91,511,445	I361K	probably damaging	Het
Trpm8	A	G	1: 88,328,196	Y191C	probably damaging	Het
Ubr3	T	C	2: 69,973,468	V1135A	possibly damaging	Het
Usp12	C	A	5: 146,754,369		probably null	Het
Vmn1r44	C	A	6: 89,893,836	P188Q	probably benign	Het
Xirp2	T	A	2: 67,525,755	V3620D	possibly damaging	Het
Zcchc14	A	T	8: 121,608,500	S294T	unknown	Het
Zfp800	T	C	6: 28,260,765	D5G	probably damaging	Het
Zfp87	C	T	13: 67,517,293	R350Q	probably benign	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTGCAAGGTGCCCTGTGAG -3'
(R):5'- AGTCAGATGCCACAGGAAGC -3'

Sequencing Primer
(F):5'- CCTGTGAGGGCGCTTATC -3'
(R):5'- CCATGAACAGGATGATTGATGAACTC -3'

Posted On

2019-10-24