Incidental Mutation 'R7597:Rai14'
ID 587806
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Name retinoic acid induced 14
Synonyms 1700020L11Rik, Ankycorbin, 1700008J19Rik, Norpeg
MMRRC Submission 045672-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # R7597 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 10569055-10714710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10574937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 703 (S703P)
Ref Sequence ENSEMBL: ENSMUSP00000087815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
AlphaFold Q9EP71
Predicted Effect possibly damaging
Transcript: ENSMUST00000090339
AA Change: S703P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: S703P

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169385
AA Change: S703P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: S703P

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: S674P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,644,661 (GRCm39) L838P probably damaging Het
Adam34l T G 8: 44,078,281 (GRCm39) N648H probably damaging Het
Adgrl4 T A 3: 151,248,895 (GRCm39) F728I probably damaging Het
Asap1 A G 15: 64,184,304 (GRCm39) V7A probably benign Het
B230104I21Rik A G 4: 154,434,050 (GRCm39) probably benign Het
C4b A T 17: 34,958,649 (GRCm39) S562T probably benign Het
Carmil2 A G 8: 106,422,121 (GRCm39) Y1130C probably damaging Het
Cit A T 5: 116,024,740 (GRCm39) K328* probably null Het
Col18a1 T C 10: 76,949,137 (GRCm39) D125G unknown Het
Cxadr T C 16: 78,125,996 (GRCm39) V122A probably damaging Het
Cyp2d22 G A 15: 82,260,053 (GRCm39) P44S probably damaging Het
Elapor1 A G 3: 108,378,745 (GRCm39) V351A possibly damaging Het
Gabrr1 A G 4: 33,148,964 (GRCm39) T74A probably benign Het
Gfm2 C A 13: 97,309,086 (GRCm39) A597E probably benign Het
H2-T22 T C 17: 36,351,408 (GRCm39) Y274C probably damaging Het
Has2 C A 15: 56,531,817 (GRCm39) W299C probably damaging Het
Hsd17b6 A G 10: 127,827,227 (GRCm39) S282P probably benign Het
Itga1 T C 13: 115,110,676 (GRCm39) I972V probably benign Het
Itih5 T A 2: 10,254,187 (GRCm39) Y813N probably damaging Het
Kctd16 A G 18: 40,663,848 (GRCm39) T326A possibly damaging Het
Klhdc1 T C 12: 69,316,642 (GRCm39) S342P probably damaging Het
Kmt2a T C 9: 44,742,650 (GRCm39) I1682M unknown Het
Lamc1 T C 1: 153,116,200 (GRCm39) K994E possibly damaging Het
Lig1 T G 7: 13,030,270 (GRCm39) S416A probably benign Het
Lims1 A G 10: 58,248,263 (GRCm39) E240G probably damaging Het
Lnpk T C 2: 74,399,316 (GRCm39) M76V probably benign Het
Lrrtm4 T A 6: 79,999,428 (GRCm39) L280* probably null Het
Mfap3l A T 8: 61,124,315 (GRCm39) I186F possibly damaging Het
Mta3 T C 17: 84,083,011 (GRCm39) F234L probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mybpc2 C T 7: 44,159,223 (GRCm39) G609D probably damaging Het
Naga A T 15: 82,219,035 (GRCm39) D237E probably benign Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nbn G A 4: 15,963,911 (GRCm39) S104N probably damaging Het
Nipsnap2 T C 5: 129,816,637 (GRCm39) L60P probably damaging Het
Or4f47 T A 2: 111,972,925 (GRCm39) F212I probably benign Het
Or8b1b G A 9: 38,375,802 (GRCm39) G155D probably benign Het
Pclo C T 5: 14,727,601 (GRCm39) T2153I unknown Het
Pclo A C 5: 14,908,869 (GRCm39) K5059T unknown Het
Pdlim2 C A 14: 70,403,645 (GRCm39) A256S possibly damaging Het
Pira2 T C 7: 3,845,460 (GRCm39) D308G probably damaging Het
Proc G T 18: 32,256,689 (GRCm39) A326E probably damaging Het
Rab40b T C 11: 121,248,709 (GRCm39) D182G probably benign Het
Rdx C T 9: 51,972,196 (GRCm39) P2L possibly damaging Het
Recql5 T C 11: 115,819,207 (GRCm39) K120E probably benign Het
Rev3l C T 10: 39,698,880 (GRCm39) R1126C probably damaging Het
Slc2a6 G T 2: 26,917,195 (GRCm39) D70E possibly damaging Het
Slc6a17 A T 3: 107,378,668 (GRCm39) D671E possibly damaging Het
Slc7a8 G A 14: 55,018,857 (GRCm39) probably benign Het
Srpk2 A G 5: 23,753,517 (GRCm39) Y79H possibly damaging Het
Traf3ip1 T A 1: 91,439,167 (GRCm39) I361K probably damaging Het
Trpm8 A G 1: 88,255,918 (GRCm39) Y191C probably damaging Het
Ubr3 T C 2: 69,803,812 (GRCm39) V1135A possibly damaging Het
Usp12 C A 5: 146,691,179 (GRCm39) probably null Het
Vmn1r44 C A 6: 89,870,818 (GRCm39) P188Q probably benign Het
Xirp2 T A 2: 67,356,099 (GRCm39) V3620D possibly damaging Het
Zcchc14 A T 8: 122,335,239 (GRCm39) S294T unknown Het
Zfp800 T C 6: 28,260,764 (GRCm39) D5G probably damaging Het
Zfp87 C T 13: 67,665,412 (GRCm39) R350Q probably benign Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10,599,797 (GRCm39) splice site probably benign
IGL01625:Rai14 APN 15 10,572,460 (GRCm39) missense probably benign 0.30
IGL01925:Rai14 APN 15 10,595,948 (GRCm39) missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10,633,242 (GRCm39) missense probably benign 0.00
IGL02531:Rai14 APN 15 10,574,868 (GRCm39) missense probably damaging 1.00
IGL02748:Rai14 APN 15 10,589,421 (GRCm39) missense probably benign 0.14
IGL02945:Rai14 APN 15 10,574,795 (GRCm39) missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10,575,242 (GRCm39) missense probably damaging 1.00
R1400:Rai14 UTSW 15 10,571,634 (GRCm39) missense probably damaging 0.98
R1583:Rai14 UTSW 15 10,588,002 (GRCm39) missense probably damaging 1.00
R1686:Rai14 UTSW 15 10,592,282 (GRCm39) missense probably damaging 0.98
R1721:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1867:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1868:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1998:Rai14 UTSW 15 10,595,067 (GRCm39) splice site probably null
R2118:Rai14 UTSW 15 10,575,252 (GRCm39) missense probably benign 0.00
R3161:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10,592,298 (GRCm39) missense probably benign 0.30
R4611:Rai14 UTSW 15 10,592,224 (GRCm39) missense probably damaging 1.00
R4760:Rai14 UTSW 15 10,575,776 (GRCm39) missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10,572,556 (GRCm39) missense probably damaging 0.99
R5022:Rai14 UTSW 15 10,574,592 (GRCm39) missense probably damaging 0.96
R5110:Rai14 UTSW 15 10,690,496 (GRCm39) start gained probably benign
R5410:Rai14 UTSW 15 10,575,024 (GRCm39) missense probably damaging 1.00
R5643:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5644:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5681:Rai14 UTSW 15 10,575,206 (GRCm39) missense probably damaging 1.00
R5934:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably damaging 0.98
R6333:Rai14 UTSW 15 10,575,022 (GRCm39) nonsense probably null
R6338:Rai14 UTSW 15 10,575,062 (GRCm39) missense probably damaging 1.00
R6864:Rai14 UTSW 15 10,633,254 (GRCm39) missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10,589,401 (GRCm39) nonsense probably null
R7155:Rai14 UTSW 15 10,595,089 (GRCm39) missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10,571,622 (GRCm39) missense probably benign 0.02
R7574:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,574,914 (GRCm39) missense probably benign
R7658:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7779:Rai14 UTSW 15 10,593,112 (GRCm39) missense probably damaging 1.00
R7946:Rai14 UTSW 15 10,574,287 (GRCm39) splice site probably null
R8171:Rai14 UTSW 15 10,633,249 (GRCm39) missense probably damaging 1.00
R8195:Rai14 UTSW 15 10,575,302 (GRCm39) missense probably benign
R8471:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably benign 0.01
R8485:Rai14 UTSW 15 10,575,122 (GRCm39) missense probably damaging 1.00
R9075:Rai14 UTSW 15 10,589,403 (GRCm39) missense probably damaging 1.00
R9287:Rai14 UTSW 15 10,592,204 (GRCm39) missense probably benign 0.14
R9502:Rai14 UTSW 15 10,587,947 (GRCm39) missense possibly damaging 0.50
R9603:Rai14 UTSW 15 10,595,116 (GRCm39) nonsense probably null
R9665:Rai14 UTSW 15 10,574,803 (GRCm39) missense probably damaging 1.00
R9767:Rai14 UTSW 15 10,610,127 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAGGTGCCCTGTGAG -3'
(R):5'- AGTCAGATGCCACAGGAAGC -3'

Sequencing Primer
(F):5'- CCTGTGAGGGCGCTTATC -3'
(R):5'- CCATGAACAGGATGATTGATGAACTC -3'
Posted On 2019-10-24