Incidental Mutation 'R7597:Has2'
ID587807
Institutional Source Beutler Lab
Gene Symbol Has2
Ensembl Gene ENSMUSG00000022367
Gene Namehyaluronan synthase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location56665627-56694539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56668421 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 299 (W299C)
Ref Sequence ENSEMBL: ENSMUSP00000062212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050544
AA Change: W299C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062212
Gene: ENSMUSG00000022367
AA Change: W299C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:Glycos_transf_2 86 156 1.7e-7 PFAM
Pfam:Glyco_tranf_2_3 159 357 1.2e-17 PFAM
Pfam:Chitin_synth_2 193 464 1.9e-17 PFAM
Pfam:Glyco_trans_2_3 207 534 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation die during midgestation with severe defects in yolk sac and systemic vasculature, including pericardial edema, compaction of the extracellular space, and absence of endocardial cushions and trabeculae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Has2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Has2 APN 15 56681676 missense possibly damaging 0.51
IGL02027:Has2 APN 15 56668171 missense probably damaging 1.00
IGL02178:Has2 APN 15 56682060 missense probably damaging 1.00
IGL02493:Has2 APN 15 56667924 missense probably damaging 1.00
IGL02533:Has2 APN 15 56681695 missense probably benign 0.00
IGL03142:Has2 APN 15 56682095 missense possibly damaging 0.92
IGL03240:Has2 APN 15 56668260 missense probably damaging 1.00
R0189:Has2 UTSW 15 56668435 missense probably damaging 1.00
R0362:Has2 UTSW 15 56681661 missense probably damaging 1.00
R1377:Has2 UTSW 15 56681806 missense probably damaging 1.00
R1762:Has2 UTSW 15 56681610 missense probably benign 0.13
R1845:Has2 UTSW 15 56668578 missense probably damaging 1.00
R2012:Has2 UTSW 15 56667868 missense probably damaging 1.00
R2190:Has2 UTSW 15 56667787 missense probably benign 0.00
R2656:Has2 UTSW 15 56681828 missense possibly damaging 0.90
R2966:Has2 UTSW 15 56682137 missense probably damaging 1.00
R4361:Has2 UTSW 15 56681948 missense probably damaging 1.00
R5698:Has2 UTSW 15 56667916 missense probably damaging 1.00
R5826:Has2 UTSW 15 56668102 missense probably damaging 1.00
R5883:Has2 UTSW 15 56668063 missense possibly damaging 0.49
R5942:Has2 UTSW 15 56667796 nonsense probably null
R6433:Has2 UTSW 15 56667798 missense possibly damaging 0.79
R6560:Has2 UTSW 15 56668264 missense probably damaging 1.00
R6603:Has2 UTSW 15 56668572 missense probably damaging 1.00
R7094:Has2 UTSW 15 56681621 missense probably damaging 1.00
R7738:Has2 UTSW 15 56667712 missense possibly damaging 0.89
R8060:Has2 UTSW 15 56669945 missense probably benign 0.00
Z1177:Has2 UTSW 15 56681583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGAAGTAGGACTTGCTCCAAC -3'
(R):5'- TAGTCTCAGGGTACTTCGGG -3'

Sequencing Primer
(F):5'- TAGGACTTGCTCCAACGGGTC -3'
(R):5'- ACCTCTTGGTATTATTAGGCTAAGGC -3'
Posted On2019-10-24