Incidental Mutation 'R0624:Hsd3b5'
ID 58781
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms 3(beta)HSDV
MMRRC Submission 038813-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R0624 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 98525950-98537568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98526720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 242 (D242G)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
AlphaFold Q61694
Predicted Effect probably damaging
Transcript: ENSMUST00000044094
AA Change: D242G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: D242G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,030,446 (GRCm39) D767V probably damaging Het
Add1 T A 5: 34,763,197 (GRCm39) N128K probably damaging Het
Ado A T 10: 67,384,058 (GRCm39) D182E probably benign Het
Anapc4 T A 5: 53,002,761 (GRCm39) probably benign Het
Ano10 A G 9: 122,088,661 (GRCm39) probably benign Het
Apba2 A G 7: 64,364,263 (GRCm39) probably null Het
Apc2 A G 10: 80,150,417 (GRCm39) T1795A probably benign Het
Atp4a A G 7: 30,418,424 (GRCm39) N571D probably benign Het
Birc6 A G 17: 74,887,344 (GRCm39) N891D probably benign Het
Bltp2 G A 11: 78,159,283 (GRCm39) E494K probably damaging Het
Car3 G T 3: 14,931,864 (GRCm39) M78I probably benign Het
Cc2d2a A T 5: 43,887,371 (GRCm39) H1267L probably benign Het
Cdk18 A G 1: 132,046,610 (GRCm39) L192P probably damaging Het
Cdk9 A T 2: 32,599,836 (GRCm39) Y134N probably damaging Het
Ceacam5 A T 7: 17,448,888 (GRCm39) T85S probably benign Het
Cenpe A G 3: 134,952,347 (GRCm39) T1403A probably benign Het
Chd8 C T 14: 52,457,214 (GRCm39) G918D possibly damaging Het
Csnk1e T A 15: 79,304,098 (GRCm39) probably benign Het
Dctpp1 A T 7: 126,856,365 (GRCm39) I119N probably damaging Het
Defb34 T A 8: 19,173,784 (GRCm39) F6Y unknown Het
Dnai4 T C 4: 102,930,054 (GRCm39) probably benign Het
Dvl1 C G 4: 155,939,232 (GRCm39) N248K probably damaging Het
Dync1h1 T C 12: 110,618,181 (GRCm39) probably benign Het
Dync2i1 T C 12: 116,211,910 (GRCm39) D199G probably damaging Het
Eml5 T A 12: 98,831,738 (GRCm39) R407W probably damaging Het
Epb41l5 T C 1: 119,551,688 (GRCm39) D99G probably damaging Het
Fat1 A T 8: 45,504,205 (GRCm39) N4566I possibly damaging Het
Gm21834 T C 17: 58,049,015 (GRCm39) E67G possibly damaging Het
Gsap T A 5: 21,458,949 (GRCm39) probably null Het
Guf1 T C 5: 69,715,923 (GRCm39) I108T probably damaging Het
Kcna7 A G 7: 45,059,114 (GRCm39) D467G probably null Het
Lars1 A G 18: 42,375,849 (GRCm39) probably benign Het
Lrrc56 A T 7: 140,786,366 (GRCm39) D248V probably damaging Het
Map3k14 T A 11: 103,133,117 (GRCm39) E27V possibly damaging Het
Med12l G A 3: 58,945,123 (GRCm39) W116* probably null Het
Mgll A G 6: 88,702,799 (GRCm39) R33G probably damaging Het
Mmp13 A G 9: 7,280,221 (GRCm39) S384G possibly damaging Het
Nalcn C T 14: 123,607,444 (GRCm39) C675Y probably benign Het
Nrxn1 A G 17: 91,396,117 (GRCm39) L13P unknown Het
Ocstamp A G 2: 165,239,772 (GRCm39) V138A probably damaging Het
Or12e8 T G 2: 87,188,026 (GRCm39) Y79* probably null Het
Or2z8 T A 8: 72,812,006 (GRCm39) S161T possibly damaging Het
Or4a68 A G 2: 89,270,482 (GRCm39) V47A possibly damaging Het
Or4f7 T C 2: 111,645,056 (GRCm39) N5S probably damaging Het
Or5p51 A G 7: 107,444,323 (GRCm39) S206P possibly damaging Het
Or9i1b T G 19: 13,896,808 (GRCm39) C141W probably damaging Het
Patj T C 4: 98,569,472 (GRCm39) probably benign Het
Pcdhb22 A G 18: 37,651,780 (GRCm39) I83V probably benign Het
Pclo A G 5: 14,719,670 (GRCm39) E1269G unknown Het
Plagl2 T C 2: 153,077,973 (GRCm39) T3A probably benign Het
Plcb1 C T 2: 135,136,831 (GRCm39) P309S possibly damaging Het
Pld3 A T 7: 27,239,000 (GRCm39) L175Q possibly damaging Het
Prrx1 A G 1: 163,075,974 (GRCm39) probably benign Het
Psap T G 10: 60,135,345 (GRCm39) probably benign Het
Ptgfr G A 3: 151,540,839 (GRCm39) T223M probably damaging Het
Reep2 A T 18: 34,973,824 (GRCm39) I6F probably benign Het
Rraga A G 4: 86,494,454 (GRCm39) E100G probably benign Het
Rrm2b T C 15: 37,931,889 (GRCm39) D37G probably benign Het
Rtl1 T C 12: 109,559,153 (GRCm39) I895M probably damaging Het
Ryr1 G A 7: 28,774,034 (GRCm39) A2445V probably damaging Het
Sbf1 C T 15: 89,186,532 (GRCm39) D898N possibly damaging Het
Sh3d19 G A 3: 86,022,213 (GRCm39) V548I possibly damaging Het
Shf C A 2: 122,199,116 (GRCm39) probably benign Het
Sipa1l3 T C 7: 29,086,676 (GRCm39) E638G probably damaging Het
Slc13a3 G T 2: 165,253,807 (GRCm39) P449T probably damaging Het
Slc2a13 C T 15: 91,234,215 (GRCm39) V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 (GRCm38) probably null Het
Slc7a2 T A 8: 41,361,568 (GRCm39) S414T probably benign Het
Slc9c1 A G 16: 45,393,719 (GRCm39) E554G probably benign Het
Smad2 T C 18: 76,433,064 (GRCm39) I332T probably damaging Het
Snrnp40 C T 4: 130,256,451 (GRCm39) P59S probably damaging Het
Sorcs2 A T 5: 36,222,777 (GRCm39) I154N probably damaging Het
Sort1 G A 3: 108,255,946 (GRCm39) G631S probably damaging Het
Sox10 T C 15: 79,043,586 (GRCm39) D149G possibly damaging Het
Spn C T 7: 126,735,380 (GRCm39) V376M possibly damaging Het
Tacc2 A G 7: 130,179,239 (GRCm39) D9G probably damaging Het
Tapt1 T G 5: 44,334,448 (GRCm39) L514F possibly damaging Het
Tcf3 A G 10: 80,249,168 (GRCm39) L480P probably damaging Het
Tenm4 G C 7: 96,423,227 (GRCm39) G637A probably damaging Het
Tex14 T A 11: 87,411,525 (GRCm39) N950K probably benign Het
Tgfbrap1 T G 1: 43,098,289 (GRCm39) H497P probably benign Het
Tnfrsf18 A T 4: 156,110,986 (GRCm39) Y48F possibly damaging Het
Tnxb A C 17: 34,902,522 (GRCm39) H1002P probably damaging Het
Ttn A G 2: 76,593,571 (GRCm39) probably benign Het
Ugt2b34 C G 5: 87,041,591 (GRCm39) probably null Het
Vldlr A G 19: 27,215,663 (GRCm39) D220G possibly damaging Het
Vmn1r33 A T 6: 66,589,121 (GRCm39) Y144* probably null Het
Xrcc4 T C 13: 90,140,594 (GRCm39) E205G possibly damaging Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98,537,373 (GRCm39) missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98,537,414 (GRCm39) missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98,526,439 (GRCm39) missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98,529,475 (GRCm39) missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98,537,421 (GRCm39) missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98,529,343 (GRCm39) missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98,529,447 (GRCm39) missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98,526,460 (GRCm39) missense probably benign
R0745:Hsd3b5 UTSW 3 98,526,855 (GRCm39) missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98,526,671 (GRCm39) missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98,537,393 (GRCm39) missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98,526,846 (GRCm39) missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98,529,393 (GRCm39) missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98,527,036 (GRCm39) missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98,527,044 (GRCm39) missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98,526,528 (GRCm39) missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98,527,116 (GRCm39) missense possibly damaging 0.88
R3158:Hsd3b5 UTSW 3 98,529,375 (GRCm39) missense probably benign 0.00
R4573:Hsd3b5 UTSW 3 98,526,964 (GRCm39) missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98,526,379 (GRCm39) missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98,526,592 (GRCm39) missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98,526,466 (GRCm39) missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98,537,406 (GRCm39) missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98,529,328 (GRCm39) missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98,527,085 (GRCm39) missense probably damaging 0.97
R7339:Hsd3b5 UTSW 3 98,529,390 (GRCm39) missense probably damaging 1.00
R7615:Hsd3b5 UTSW 3 98,537,420 (GRCm39) missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98,526,757 (GRCm39) missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98,529,456 (GRCm39) missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98,526,720 (GRCm39) missense possibly damaging 0.85
R9218:Hsd3b5 UTSW 3 98,526,354 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAAACTGGACGTAGCAGGAAGCTC -3'
(R):5'- GCATCGTGAAAGCACATGGCCTAAC -3'

Sequencing Primer
(F):5'- AGCTCACAGTTTCCAGCAGG -3'
(R):5'- CCTGAAAAATGGTGGCACTTTG -3'
Posted On 2013-07-11