Incidental Mutation 'R7597:Cxadr'
ID587812
Institutional Source Beutler Lab
Gene Symbol Cxadr
Ensembl Gene ENSMUSG00000022865
Gene Namecoxsackie virus and adenovirus receptor
SynonymsMCAR, MCVADR, 2610206D03Rik, CAR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78301489-78359774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78329108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000023572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023572] [ENSMUST00000114229] [ENSMUST00000231353] [ENSMUST00000231356] [ENSMUST00000232148]
PDB Structure
Crystal structure of the extracellular domains of coxsackie & adenovirus receptor from mouse (mCAR) [X-RAY DIFFRACTION]
Crystal structure of the complex of JAML and Coxsackie and Adenovirus receptor, CAR [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023572
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023572
Gene: ENSMUSG00000022865
AA Change: V122A

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114229
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109867
Gene: ENSMUSG00000022865
AA Change: V122A

DomainStartEndE-ValueType
IG 26 138 1.99e-7 SMART
IGc2 153 219 7.7e-5 SMART
low complexity region 262 272 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000231353
Predicted Effect probably damaging
Transcript: ENSMUST00000231356
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232148
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the Cortical Thymocyte marker in Xenopus (CTX) subfamily within the immunoglobulin superfamily. Members of this subfamily, predominantly expressed on the surface of endothelial and epithelial cells, help establish cell polarity and provide a barrier function, regulating migration of immune cells. This protein, first identified as the receptor for adenovirus subgroup C and coxsakieviruses group B, is developmentally regulated and plays an important role in cardiac development. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with focal cardiomyocyte apoptosis and extensive thoracic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Cxadr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Cxadr APN 16 78334227 nonsense probably null
R0309:Cxadr UTSW 16 78334948 missense probably benign 0.00
R1129:Cxadr UTSW 16 78336433 missense probably benign 0.27
R1142:Cxadr UTSW 16 78334839 missense probably benign 0.04
R1713:Cxadr UTSW 16 78334245 missense probably damaging 1.00
R6432:Cxadr UTSW 16 78325259 missense probably damaging 1.00
R6637:Cxadr UTSW 16 78333503 missense possibly damaging 0.47
R7735:Cxadr UTSW 16 78329061 missense possibly damaging 0.92
R7809:Cxadr UTSW 16 78333519 critical splice donor site probably null
R8073:Cxadr UTSW 16 78333413 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGGCTAAGAACAAGGGATC -3'
(R):5'- AACCAGCCTTGTCTTCCATGG -3'

Sequencing Primer
(F):5'- CTTAGTGGGAAATGTGAACAGTTATG -3'
(R):5'- CATGGGCGTTGCGACTGTAC -3'
Posted On2019-10-24