Incidental Mutation 'R7597:Kctd16'
ID587817
Institutional Source Beutler Lab
Gene Symbol Kctd16
Ensembl Gene ENSMUSG00000051401
Gene Namepotassium channel tetramerisation domain containing 16
Synonyms4930434H12Rik, LOC383347
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location40258361-40531168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40530795 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 326 (T326A)
Ref Sequence ENSEMBL: ENSMUSP00000089547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091927
AA Change: T326A

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089547
Gene: ENSMUSG00000051401
AA Change: T326A

DomainStartEndE-ValueType
BTB 25 130 8.7e-7 SMART
low complexity region 288 300 N/A INTRINSIC
low complexity region 374 396 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to reduced extinction or increase of fear memory in cued or contextual conditioning behavior tests, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Kctd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Kctd16 APN 18 40258800 missense probably benign 0.01
IGL02001:Kctd16 APN 18 40258680 missense possibly damaging 0.48
IGL02173:Kctd16 APN 18 40530853 missense probably benign 0.01
IGL03112:Kctd16 APN 18 40258800 missense probably benign 0.08
R0109:Kctd16 UTSW 18 40259151 missense probably benign 0.06
R0109:Kctd16 UTSW 18 40259151 missense probably benign 0.06
R0267:Kctd16 UTSW 18 40530877 missense probably benign 0.02
R0554:Kctd16 UTSW 18 40258439 missense probably benign
R0732:Kctd16 UTSW 18 40258563 missense probably damaging 1.00
R0883:Kctd16 UTSW 18 40530775 missense probably damaging 0.98
R2140:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2141:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2142:Kctd16 UTSW 18 40259178 missense possibly damaging 0.89
R2160:Kctd16 UTSW 18 40259085 missense probably damaging 1.00
R3723:Kctd16 UTSW 18 40258859 missense possibly damaging 0.79
R3724:Kctd16 UTSW 18 40258859 missense possibly damaging 0.79
R5483:Kctd16 UTSW 18 40530876 missense probably benign
R5589:Kctd16 UTSW 18 40259008 missense probably damaging 1.00
R5767:Kctd16 UTSW 18 40258869 missense probably benign 0.13
R5811:Kctd16 UTSW 18 40258452 missense probably damaging 1.00
R5911:Kctd16 UTSW 18 40530852 missense probably benign 0.11
R5930:Kctd16 UTSW 18 40530829 missense probably benign 0.10
R6017:Kctd16 UTSW 18 40258943 missense probably damaging 1.00
R6603:Kctd16 UTSW 18 40258491 missense probably benign
R7404:Kctd16 UTSW 18 40258773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTACTAGAGTGTTCTGCAGC -3'
(R):5'- GGAGAGCTTTTCCTTCGCAG -3'

Sequencing Primer
(F):5'- AGAGTGTTCTGCAGCTTCATCAC -3'
(R):5'- GAGAGCTTTTCCTTCGCAGCTTTC -3'
Posted On2019-10-24