Incidental Mutation 'R7598:Spag16'
ID587818
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69870308 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 188 (F188S)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably damaging
Transcript: ENSMUST00000065425
AA Change: F188S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: F188S

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113940
AA Change: F188S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: F188S

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 intron probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7942:Spag16 UTSW 1 69827088 missense probably benign 0.11
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8132:Spag16 UTSW 1 70381302 missense probably damaging 1.00
R8329:Spag16 UTSW 1 69895248 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGAGTAAGACCCCGTCC -3'
(R):5'- CACACCTTAATAGTGTGAATATGGC -3'

Sequencing Primer
(F):5'- ATGCCTGAAATGCTGGGCTC -3'
(R):5'- ATGGCTTCAATTCAAGGGCC -3'
Posted On2019-10-24