Incidental Mutation 'R7598:Pip4k2a'
ID587821
Institutional Source Beutler Lab
Gene Symbol Pip4k2a
Ensembl Gene ENSMUSG00000026737
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, alpha
SynonymsPip5k2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location18842255-18998126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18872287 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 212 (L212F)
Ref Sequence ENSEMBL: ENSMUSP00000006912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006912
AA Change: L212F

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006912
Gene: ENSMUSG00000026737
AA Change: L212F

DomainStartEndE-ValueType
PIPKc 62 405 1.19e-169 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119075
Gene: ENSMUSG00000026737
AA Change: L114F

DomainStartEndE-ValueType
Pfam:PIP5K 18 198 1.4e-43 PFAM
Meta Mutation Damage Score 0.8766 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Pip4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Pip4k2a APN 2 18872336 missense probably benign 0.10
IGL01682:Pip4k2a APN 2 18997968 missense probably benign
IGL02379:Pip4k2a APN 2 18866111 critical splice donor site probably null
R0096:Pip4k2a UTSW 2 18889039 splice site probably benign
R0184:Pip4k2a UTSW 2 18889128 missense probably damaging 0.96
R0514:Pip4k2a UTSW 2 18845936 missense probably damaging 0.99
R1673:Pip4k2a UTSW 2 18872282 critical splice donor site probably null
R1779:Pip4k2a UTSW 2 18847622 missense probably benign 0.27
R2198:Pip4k2a UTSW 2 18847655 missense probably damaging 0.98
R4555:Pip4k2a UTSW 2 18872292 missense probably damaging 0.99
R5408:Pip4k2a UTSW 2 18906308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCATGTGGTACTACATGGCATG -3'
(R):5'- CGATACACCACGTTTTGACAGC -3'

Sequencing Primer
(F):5'- ACTACATGGCATGTGGCTGAC -3'
(R):5'- ACACCACGTTTTGACAGCTACTTTTC -3'
Posted On2019-10-24