Incidental Mutation 'R7598:Pde11a'
ID587823
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76136423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 561 (T561S)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably damaging
Transcript: ENSMUST00000099992
AA Change: T561S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: T561S

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144892
SMART Domains Protein: ENSMUSP00000115662
Gene: ENSMUSG00000075270

DomainStartEndE-ValueType
GAF 41 207 9.16e-19 SMART
HDc 269 438 2.04e-5 SMART
Meta Mutation Damage Score 0.2304 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1542:Pde11a UTSW 2 76046855 missense probably benign 0.25
R1941:Pde11a UTSW 2 76291250 missense probably benign 0.10
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4588:Pde11a UTSW 2 76029303 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5017:Pde11a UTSW 2 76136367 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7886:Pde11a UTSW 2 76291203 missense probably benign
R7969:Pde11a UTSW 2 76291203 missense probably benign
R8045:Pde11a UTSW 2 76022728 missense probably damaging 0.99
Z1176:Pde11a UTSW 2 76194905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTAAAAGATTCTGAGCATTCGG -3'
(R):5'- TTTAATGCACGTGTCCCTGAG -3'

Sequencing Primer
(F):5'- TTCTGAGCATTCGGAATTCTAATG -3'
(R):5'- TGTCCCTGAGGCCCACC -3'
Posted On2019-10-24