Incidental Mutation 'R7598:Agtr1b'
ID587828
Institutional Source Beutler Lab
Gene Symbol Agtr1b
Ensembl Gene ENSMUSG00000054988
Gene Nameangiotensin II receptor, type 1b
SynonymsAgtr-1b, Angtr-1b, AT1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location20314473-20367177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20315913 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 176 (N176K)
Ref Sequence ENSEMBL: ENSMUSP00000068298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068316] [ENSMUST00000163776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068316
AA Change: N176K

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068298
Gene: ENSMUSG00000054988
AA Change: N176K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 3e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163776
AA Change: N176K

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128724
Gene: ENSMUSG00000054988
AA Change: N176K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 310 5.4e-10 PFAM
Pfam:7tm_1 45 302 1.1e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal, but homozygotes for the Agtr1b/Agtr1a double knockout exhibit reductions in growth, survival, blood pressure, and kidney size not found in either single knockout. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Agtr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01558:Agtr1b APN 3 20316260 missense probably damaging 0.99
IGL02706:Agtr1b APN 3 20315863 missense probably benign 0.01
IGL02958:Agtr1b APN 3 20316094 missense possibly damaging 0.91
IGL03243:Agtr1b APN 3 20315795 missense probably benign 0.13
R0125:Agtr1b UTSW 3 20315540 missense probably benign 0.00
R0565:Agtr1b UTSW 3 20315674 missense probably damaging 0.99
R0661:Agtr1b UTSW 3 20315999 missense possibly damaging 0.83
R1070:Agtr1b UTSW 3 20315748 missense probably benign 0.34
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1469:Agtr1b UTSW 3 20315500 missense probably damaging 1.00
R1713:Agtr1b UTSW 3 20316309 missense probably benign 0.00
R4502:Agtr1b UTSW 3 20315798 missense probably damaging 1.00
R5613:Agtr1b UTSW 3 20316260 missense probably damaging 0.99
R6142:Agtr1b UTSW 3 20316394 missense probably benign 0.06
R6320:Agtr1b UTSW 3 20315779 missense probably benign 0.22
R6667:Agtr1b UTSW 3 20315749 missense possibly damaging 0.91
R6987:Agtr1b UTSW 3 20316421 missense probably benign 0.00
R7407:Agtr1b UTSW 3 20315731 missense possibly damaging 0.79
X0037:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0060:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20316388 missense probably damaging 1.00
X0063:Agtr1b UTSW 3 20315506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCATGATTATCCTAAAGATGTC -3'
(R):5'- ACCTCTACGCCAGTGTGTTC -3'

Sequencing Primer
(F):5'- AAGATGTCATCATTCCTTGGCG -3'
(R):5'- AGTGTGTTCCTGCTCACG -3'
Posted On2019-10-24