Incidental Mutation 'R7598:Arhgef15'
ID587848
Institutional Source Beutler Lab
Gene Symbol Arhgef15
Ensembl Gene ENSMUSG00000052921
Gene NameRho guanine nucleotide exchange factor (GEF) 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68943155-68957480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68946410 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 785 (L785Q)
Ref Sequence ENSEMBL: ENSMUSP00000067684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065040] [ENSMUST00000108671]
Predicted Effect probably damaging
Transcript: ENSMUST00000065040
AA Change: L785Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067684
Gene: ENSMUSG00000052921
AA Change: L785Q

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108671
AA Change: L785Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104311
Gene: ENSMUSG00000052921
AA Change: L785Q

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 84 127 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
RhoGEF 429 608 1.76e-50 SMART
low complexity region 670 680 N/A INTRINSIC
Blast:RhoGEF 688 746 1e-22 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock out allele exhibit increased excitatory synapse formation. Mice homozygous for a knock-out allele exhibit delayed radial growth, sparse vasculature and empty baselment membrane sleeves in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Arhgef15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Arhgef15 APN 11 68954102 missense probably damaging 1.00
IGL02382:Arhgef15 APN 11 68954030 missense probably damaging 0.98
R0041:Arhgef15 UTSW 11 68954516 missense possibly damaging 0.92
R0208:Arhgef15 UTSW 11 68946373 missense probably benign 0.09
R0276:Arhgef15 UTSW 11 68953472 splice site probably benign
R0368:Arhgef15 UTSW 11 68954693 missense probably damaging 0.99
R0706:Arhgef15 UTSW 11 68954576 missense probably damaging 1.00
R1628:Arhgef15 UTSW 11 68944814 missense possibly damaging 0.86
R1966:Arhgef15 UTSW 11 68954675 missense probably damaging 1.00
R2105:Arhgef15 UTSW 11 68947681 splice site probably null
R2278:Arhgef15 UTSW 11 68951691 missense probably damaging 1.00
R4667:Arhgef15 UTSW 11 68954561 missense probably benign 0.00
R4836:Arhgef15 UTSW 11 68949925 intron probably benign
R4898:Arhgef15 UTSW 11 68951345 missense probably benign 0.00
R4966:Arhgef15 UTSW 11 68947317 missense probably benign 0.08
R5304:Arhgef15 UTSW 11 68947237 missense probably null 0.32
R5333:Arhgef15 UTSW 11 68947196 intron probably benign
R5546:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5632:Arhgef15 UTSW 11 68954051 missense probably benign 0.01
R5707:Arhgef15 UTSW 11 68954715 missense probably damaging 0.98
R5839:Arhgef15 UTSW 11 68954156 missense probably benign 0.00
R5926:Arhgef15 UTSW 11 68951955 missense possibly damaging 0.76
R6376:Arhgef15 UTSW 11 68954970 missense unknown
R6429:Arhgef15 UTSW 11 68947796 missense probably damaging 1.00
R6526:Arhgef15 UTSW 11 68949994 missense probably damaging 1.00
R6749:Arhgef15 UTSW 11 68954557 missense probably damaging 0.99
R7460:Arhgef15 UTSW 11 68947035 missense probably damaging 1.00
R7529:Arhgef15 UTSW 11 68954022 missense probably damaging 1.00
R7767:Arhgef15 UTSW 11 68953847 missense probably damaging 0.99
X0067:Arhgef15 UTSW 11 68944830 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAAAGCAGACTCCAGTGC -3'
(R):5'- ACACCATCTATGAGGACTGTGG -3'

Sequencing Primer
(F):5'- CAGCATTTGCCCATCATGTGTAAGG -3'
(R):5'- CTGTGGTAAGCATCTCTCAAAGG -3'
Posted On2019-10-24