Incidental Mutation 'R7598:Hs6st3'
ID587857
Institutional Source Beutler Lab
Gene Symbol Hs6st3
Ensembl Gene ENSMUSG00000053465
Gene Nameheparan sulfate 6-O-sulfotransferase 3
Synonyms6OST3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R7598 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location119138341-119869815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119869338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 386 (V386E)
Ref Sequence ENSEMBL: ENSMUSP00000070394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065904]
Predicted Effect probably damaging
Transcript: ENSMUST00000065904
AA Change: V386E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070394
Gene: ENSMUSG00000053465
AA Change: V386E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 86 115 N/A INTRINSIC
Pfam:Sulfotransfer_2 137 410 4.7e-83 PFAM
low complexity region 425 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate (HS) sulfotransferases, such as HS6ST3, modify HS to generate structures required for interactions between HS and a variety of proteins. These interactions are implicated in proliferation and differentiation, adhesion, migration, inflammation, blood coagulation, and other diverse processes (Habuchi et al., 2000 [PubMed 10644753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rbm4 T C 19: 4,792,511 E100G possibly damaging Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Hs6st3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Hs6st3 APN 14 119139034 missense probably damaging 1.00
IGL00973:Hs6st3 APN 14 119869407 missense possibly damaging 0.58
IGL02185:Hs6st3 APN 14 119868884 critical splice acceptor site probably null
IGL02696:Hs6st3 APN 14 119869319 missense probably damaging 0.98
IGL02820:Hs6st3 APN 14 119139080 missense possibly damaging 0.95
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0241:Hs6st3 UTSW 14 119138820 missense probably benign 0.32
R0634:Hs6st3 UTSW 14 119869062 nonsense probably null
R0737:Hs6st3 UTSW 14 119869383 missense possibly damaging 0.82
R0750:Hs6st3 UTSW 14 119138707 small deletion probably benign
R1975:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R1977:Hs6st3 UTSW 14 119138476 missense probably benign 0.33
R2025:Hs6st3 UTSW 14 119869389 missense probably damaging 1.00
R2116:Hs6st3 UTSW 14 119869287 missense probably damaging 1.00
R2295:Hs6st3 UTSW 14 119138445 missense probably benign 0.15
R3154:Hs6st3 UTSW 14 119868977 missense probably damaging 0.99
R5700:Hs6st3 UTSW 14 119138787 nonsense probably null
R5744:Hs6st3 UTSW 14 119138440 missense possibly damaging 0.96
R5852:Hs6st3 UTSW 14 119869326 missense probably damaging 1.00
R5861:Hs6st3 UTSW 14 119138853 missense possibly damaging 0.89
R6262:Hs6st3 UTSW 14 119138991 missense possibly damaging 0.95
R6408:Hs6st3 UTSW 14 119138634 missense probably benign 0.44
R7140:Hs6st3 UTSW 14 119139102 missense probably damaging 1.00
R8026:Hs6st3 UTSW 14 119869556 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGCTACAACTTGACTTTCATG -3'
(R):5'- ATGGCCCTATCCTCTTTGGG -3'

Sequencing Primer
(F):5'- CTTGACTTTCATGAATGAGAGCGAGC -3'
(R):5'- ATCCTCTTTGGGCCACCGG -3'
Posted On2019-10-24