Incidental Mutation 'R7598:Rbm4'
ID587869
Institutional Source Beutler Lab
Gene Symbol Rbm4
Ensembl Gene ENSMUSG00000094936
Gene NameRNA binding motif protein 4
SynonymsLark1, Rbm4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R7598 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4784293-4793901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4792511 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000137345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164209] [ENSMUST00000164376] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000178615] [ENSMUST00000179189] [ENSMUST00000179909] [ENSMUST00000180248]
Predicted Effect probably benign
Transcript: ENSMUST00000164209
AA Change: E100G

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129745
Gene: ENSMUSG00000094936
AA Change: E100G

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164376
AA Change: E100G

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127564
Gene: ENSMUSG00000094936
AA Change: E100G

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 172 4.62e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172000
AA Change: E216G
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370
AA Change: E216G

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect probably benign
Transcript: ENSMUST00000178615
AA Change: E100G

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136254
Gene: ENSMUSG00000094936
AA Change: E100G

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179189
AA Change: E100G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137174
Gene: ENSMUSG00000094936
AA Change: E100G

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179909
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180248
AA Change: E100G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137345
Gene: ENSMUSG00000094936
AA Change: E100G

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
low complexity region 227 246 N/A INTRINSIC
low complexity region 283 296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced postnatal body weight, decreased insulin levels, smaller pancreatic islets and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 T C 2: 150,638,450 S234G probably benign Het
Agtr1b A T 3: 20,315,913 N176K possibly damaging Het
AI661453 T C 17: 47,466,120 V257A unknown Het
Alpk2 T A 18: 65,304,566 K1252M probably damaging Het
Angpt4 A G 2: 151,925,525 T159A possibly damaging Het
Ap1g1 A G 8: 109,849,676 N447S probably benign Het
Apoc4 A G 7: 19,681,340 V14A probably benign Het
Arfgef2 A C 2: 166,856,524 Q638P probably benign Het
Arhgap20 C A 9: 51,849,790 F980L possibly damaging Het
Arhgap27 G A 11: 103,334,053 R459* probably null Het
Arhgef15 A T 11: 68,946,410 L785Q probably damaging Het
B3gnt7 T C 1: 86,305,778 F249L probably benign Het
Carmil3 A G 14: 55,494,821 E233G possibly damaging Het
Ccdc122 C A 14: 77,111,566 Q279K probably benign Het
Cilp2 A G 8: 69,886,032 C134R probably benign Het
Clec4b1 G A 6: 123,071,468 W187* probably null Het
Ddx11 G A 17: 66,130,546 probably null Het
Dhrs7c A T 11: 67,811,453 probably null Het
Eif4g3 T A 4: 138,194,124 H1387Q probably benign Het
Gsdmc4 T C 15: 63,900,386 N148S probably damaging Het
Hs6st3 T A 14: 119,869,338 V386E probably damaging Het
Itih3 C T 14: 30,917,377 R413Q possibly damaging Het
Kcnj4 T C 15: 79,485,764 N5S probably benign Het
Klhl18 A T 9: 110,446,810 L155* probably null Het
Lima1 G A 15: 99,819,696 P143L probably benign Het
Lzts2 G T 19: 45,023,833 G234* probably null Het
Map4k5 A T 12: 69,824,638 F503L possibly damaging Het
Men1 A T 19: 6,339,705 I463L probably benign Het
Muc5b A G 7: 141,859,262 T1982A unknown Het
Myo18a A T 11: 77,847,346 T1705S probably damaging Het
Nipbl T C 15: 8,343,493 S1090G probably benign Het
Olfr1066 C A 2: 86,455,890 C127F probably damaging Het
Olfr1535 T C 13: 21,555,188 Y278C probably damaging Het
Pcdhb7 T C 18: 37,342,780 F323S probably damaging Het
Pde11a T A 2: 76,136,423 T561S probably damaging Het
Phip A C 9: 82,905,658 S817R possibly damaging Het
Phxr2 T A 10: 99,126,079 M40L unknown Het
Pip4k2a T A 2: 18,872,287 L212F possibly damaging Het
Proc T A 18: 32,135,876 I19L probably benign Het
Rhobtb3 T C 13: 75,910,902 Y259C probably benign Het
Rtkn A G 6: 83,147,903 D168G probably null Het
Sdk1 T G 5: 141,609,998 Y136* probably null Het
Slk G A 19: 47,636,462 E1041K probably damaging Het
Smok2b A T 17: 13,236,086 R378* probably null Het
Sp110 G A 1: 85,579,092 R417C Het
Spag16 T C 1: 69,870,308 F188S probably damaging Het
Tlnrd1 A G 7: 83,882,630 C198R probably damaging Het
Tor1a A C 2: 30,967,784 I24S probably benign Het
Unc13b C A 4: 43,263,569 T1598K probably benign Het
Uncx G A 5: 139,544,054 V21M probably benign Het
Usp5 A T 6: 124,826,379 F53I possibly damaging Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Zfp654 T A 16: 64,785,934 E94V possibly damaging Het
Zfp689 A G 7: 127,448,668 L64P probably benign Het
Zfyve28 A C 5: 34,236,117 N68K probably damaging Het
Other mutations in Rbm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0311:Rbm4 UTSW 19 4787556 missense probably damaging 1.00
R2093:Rbm4 UTSW 19 4787764 missense probably damaging 0.99
R3693:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3694:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3695:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R6103:Rbm4 UTSW 19 4787919 missense probably damaging 0.98
R7810:Rbm4 UTSW 19 4792622 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATCCTTCATCAGCCAGC -3'
(R):5'- TGGCTTTGTGCACATAGAGG -3'

Sequencing Primer
(F):5'- TGATCCTTCATCAGCCAGCAAAATC -3'
(R):5'- CTTTGTGCACATAGAGGACAAGAC -3'
Posted On2019-10-24